Transcript: Human XR_931527.3

PREDICTED: Homo sapiens ubiquitin specific peptidase 5 (USP5), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
USP5 (8078)
Length:
3215
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_931527.3
NBCI Gene record:
USP5 (8078)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_931527.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000306799 CGGGCCACGAACAATAGTTTA pLKO_005 2319 3UTR 100% 13.200 18.480 N USP5 n/a
2 TRCN0000030738 CGAGGATGTGAAGATTGTCAT pLKO.1 393 3UTR 100% 4.950 6.930 N Usp5 n/a
3 TRCN0000288462 CGAGGATGTGAAGATTGTCAT pLKO_005 393 3UTR 100% 4.950 6.930 N Usp5 n/a
4 TRCN0000004067 CGGCTGGCTATTGGTGTTGAA pLKO.1 334 3UTR 100% 4.950 6.930 N USP5 n/a
5 TRCN0000004069 GACCACACGATTTGCCTCATT pLKO.1 1716 3UTR 100% 4.950 6.930 N USP5 n/a
6 TRCN0000004070 AGCGAGGAGAAGTTTGAATTA pLKO.1 370 3UTR 100% 13.200 10.560 N USP5 n/a
7 TRCN0000293541 AGGATGTGAAGATTGTCATTT pLKO_005 395 3UTR 100% 13.200 9.240 N USP5 n/a
8 TRCN0000293540 CCTGTCTGTAAGGAGACTTTG pLKO_005 2882 3UTR 100% 10.800 7.560 N USP5 n/a
9 TRCN0000030737 CCTGGGCTACATCTACTTCTA pLKO.1 2621 3UTR 100% 4.950 3.465 N Usp5 n/a
10 TRCN0000288536 CCTGGGCTACATCTACTTCTA pLKO_005 2621 3UTR 100% 4.950 3.465 N Usp5 n/a
11 TRCN0000004068 GATAGACATGAACCAGCGGAT pLKO.1 933 3UTR 100% 2.160 1.512 N USP5 n/a
12 TRCN0000293539 GATAGACATGAACCAGCGGAT pLKO_005 933 3UTR 100% 2.160 1.512 N USP5 n/a
13 TRCN0000004066 CTTTGCCTTCATTAGTCACAT pLKO.1 2492 3UTR 100% 4.950 2.970 N USP5 n/a
14 TRCN0000293604 CTTTGCCTTCATTAGTCACAT pLKO_005 2492 3UTR 100% 4.950 2.970 N USP5 n/a
15 TRCN0000030735 CCCTTAACAAAGAGGAGCTTT pLKO.1 1529 3UTR 100% 4.950 3.465 N Usp5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_931527.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07199 pDONR223 100% 77.8% None (many diffs) n/a
2 ccsbBroad304_07199 pLX_304 0% 77.8% V5 (many diffs) n/a
3 TRCN0000479065 CTGAAGCACGAAGCTAGGCAGTTT pLX_317 16.3% 77.8% V5 (many diffs) n/a
Download CSV