Transcript: Human NM_001177549.3

Homo sapiens sialic acid binding Ig like lectin 6 (SIGLEC6), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
SIGLEC6 (946)
Length:
3438
CDS:
23..1051

Additional Resources:

NCBI RefSeq record:
NM_001177549.3
NBCI Gene record:
SIGLEC6 (946)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001177549.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061984 CCAGCCTCGTACTATGGTTAT pLKO.1 194 CDS 100% 10.800 15.120 N SIGLEC6 n/a
2 TRCN0000061986 CGACACTGAGTACTCAGAAAT pLKO.1 1139 3UTR 100% 13.200 9.240 N SIGLEC6 n/a
3 TRCN0000061983 GCCCAGAAACTATAATAACAT pLKO.1 3332 3UTR 100% 5.625 3.938 N SIGLEC6 n/a
4 TRCN0000061987 CAAATGGATGAAATACGGTTA pLKO.1 397 CDS 100% 4.050 2.835 N SIGLEC6 n/a
5 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2637 3UTR 100% 4.950 2.475 Y ERAP2 n/a
6 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2638 3UTR 100% 13.200 6.600 Y LIAS n/a
7 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 2069 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001177549.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05960 pDONR223 100% 71.9% 67% None (many diffs) n/a
2 ccsbBroad304_05960 pLX_304 0% 71.9% 67% V5 (many diffs) n/a
3 TRCN0000479238 GAATCGGAATACCCGAACCGGAGC pLX_317 26.8% 71.9% 67% V5 (many diffs) n/a
Download CSV