Construct: ORF TRCN0000479508
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016675.1_s317c1
- Derived from:
- ccsbBroadEn_05987
- DNA Barcode:
- AGGTGCAAGGTGGAACATCCGCTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CGB3 (1082)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479508
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 93659 | CGB5 | chorionic gonadotropin subu... | NM_033043.2 | 99.7% | 100% | 438C>G |
2 | human | 94115 | CGB8 | chorionic gonadotropin subu... | NM_033183.2 | 99.7% | 100% | 438C>G |
3 | human | 1082 | CGB3 | chorionic gonadotropin subu... | NM_000737.3 | 99.5% | 100% | 438C>G;450C>T |
4 | human | 94027 | CGB7 | chorionic gonadotropin subu... | NM_033142.1 | 98.7% | 98.1% | (many diffs) |
5 | human | 94027 | CGB7 | chorionic gonadotropin subu... | XM_024451784.1 | 98.7% | 98.1% | (many diffs) |
6 | human | 114336 | CGB2 | chorionic gonadotropin subu... | NM_033378.1 | 97.3% | 96.9% | (many diffs) |
7 | human | 114335 | CGB1 | chorionic gonadotropin subu... | NM_033377.1 | 92.7% | 92.1% | (many diffs) |
8 | human | 114336 | CGB2 | chorionic gonadotropin subu... | NM_001319065.1 | 90.7% | 90.9% | (many diffs) |
9 | human | 114336 | CGB2 | chorionic gonadotropin subu... | XM_005258479.3 | 89.6% | 88.3% | (many diffs) |
10 | human | 3972 | LHB | luteinizing hormone subunit... | NM_000894.2 | 78.4% | 68.2% | (many diffs) |
11 | human | 3972 | LHB | luteinizing hormone subunit... | XM_011526975.1 | 70.9% | 60.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 561
- ORF length:
- 495
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gatgttccag gggctgctgc tgttgctgct gctgagcatg ggcgggacat 121 gggcatccaa ggagccgctt cggccacggt gccgccccat caatgccacc ctggctgtgg 181 agaaggaggg ctgccccgtg tgcatcaccg tcaacaccac catctgtgcc ggctactgcc 241 ccaccatgac ccgcgtgctg cagggggtcc tgccggccct gcctcaggtg gtgtgcaact 301 accgcgatgt gcgcttcgag tccatccggc tccctggctg cccgcgcggc gtgaaccccg 361 tggtctccTA CGCCGTGGCT CTCAGCTGTC AATGTGCACT CTGCCGCCGC AGCACCACTG 421 ACTGCGGGGG TCCCAAGGAC CACCCCTTGA CCTGTGATGA CCCCCGCTTC CAGGACTCCT 481 CTTCCTCAAA GGCCCCTCCC CCGAGCCTTC CAAGTCCATC CCGACTCCCG GGGCCCTCGG 541 ACACCCCGAT CCTCCCACAA TACCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 601 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 661 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAAGGT GCAAGGTGGA 721 ACATCCGCTA ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt