Transcript: Human XM_024451784.1

PREDICTED: Homo sapiens chorionic gonadotropin subunit beta 7 (CGB7), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CGB7 (94027)
Length:
1863
CDS:
1349..1846

Additional Resources:

NCBI RefSeq record:
XM_024451784.1
NBCI Gene record:
CGB7 (94027)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451784.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244626 GACATGGGCATCCAGGGAGAT pLKO_005 1399 CDS 100% 1.350 0.810 N CGB7 n/a
2 TRCN0000256848 GTGGCTCTCAGCTGTCAATGT pLKO_005 1658 CDS 100% 4.950 2.475 Y CGB8 n/a
3 TRCN0000256994 TGGCTCTCAGCTGTCAATGTG pLKO_005 1659 CDS 100% 4.950 2.475 Y CGB7 n/a
4 TRCN0000369665 ATCACCGTCAACACCACCATC pLKO_005 1487 CDS 100% 4.050 2.025 Y CGB7 n/a
5 TRCN0000256847 TCACCGTCAACACCACCATCT pLKO_005 1488 CDS 100% 4.050 2.025 Y CGB8 n/a
6 TRCN0000262693 ACCGTCAACACCACCATCTGT pLKO_005 1490 CDS 100% 3.000 1.500 Y CGB5 n/a
7 TRCN0000082825 CATCACCGTCAACACCACCAT pLKO.1 1486 CDS 100% 2.640 1.320 Y CGB3 n/a
8 TRCN0000262695 AGCTGTCAATGTGCACTCTGC pLKO_005 1667 CDS 100% 2.160 1.080 Y CGB5 n/a
9 TRCN0000082823 CCGTGGCTCTCAGCTGTCAAT pLKO.1 1656 CDS 100% 1.650 0.825 Y CGB3 n/a
10 TRCN0000082827 CCGTGTGCATCACCGTCAACA pLKO.1 1479 CDS 100% 1.650 0.825 Y CGB3 n/a
11 TRCN0000377304 CTCAGGTGGTGTGCAACTACC pLKO_005 1566 CDS 100% 1.350 0.675 Y CGB7 n/a
12 TRCN0000244627 GATGTGCGCTTCGAGTCCATC pLKO_005 1589 CDS 100% 1.350 0.675 Y CGB7 n/a
13 TRCN0000256849 GGTGTGCAACTACCGCGATGT pLKO_005 1573 CDS 100% 1.350 0.675 Y CGB8 n/a
14 TRCN0000281558 GTGTGCAACTACCGCGATGTG pLKO_005 1574 CDS 100% 1.350 0.675 Y CGB5 n/a
15 TRCN0000082826 CGATGTGCGCTTCGAGTCCAT pLKO.1 1588 CDS 100% 0.880 0.440 Y CGB3 n/a
16 TRCN0000242639 ATCAATGCCACCCTGGCTGTG pLKO_005 1442 CDS 100% 0.750 0.375 Y CGB2 n/a
17 TRCN0000256850 ATGTGCGCTTCGAGTCCATCC pLKO_005 1590 CDS 100% 0.750 0.375 Y CGB8 n/a
18 TRCN0000377340 TGTTGCTGCTGCTGAGCATGG pLKO_005 1374 CDS 100% 0.750 0.375 Y CGB8 n/a
19 TRCN0000262694 CATCAATGCCACCCTGGCTGT pLKO_005 1441 CDS 100% 0.720 0.360 Y CGB5 n/a
20 TRCN0000082824 GTGGTGTGCAACTACCGCGAT pLKO.1 1571 CDS 100% 0.720 0.360 Y CGB3 n/a
21 TRCN0000242637 TGTCAATGTGCACTCTGCCGC pLKO_005 1670 CDS 100% 0.180 0.090 Y CGB2 n/a
22 TRCN0000377297 ACCATGACCCGCGTGCTGCAG pLKO_005 1526 CDS 100% 0.000 0.000 Y CGB7 n/a
23 TRCN0000242876 AGTCCATCCGGCTCCCTGGCT pLKO_005 1602 CDS 100% 0.000 0.000 Y CGB1 n/a
24 TRCN0000083467 CACCACCATCTGTGCCGGCTA pLKO.1 1498 CDS 100% 0.000 0.000 Y LHB n/a
25 TRCN0000242638 CACCATCTGTGCCGGCTACTG pLKO_005 1501 CDS 100% 0.000 0.000 Y CGB2 n/a
26 TRCN0000242874 CACCATGACCCGCGTGCTGCA pLKO_005 1525 CDS 100% 0.000 0.000 Y CGB1 n/a
27 TRCN0000369594 CCACCATCTGTGCCGGCTACT pLKO_005 1500 CDS 100% 0.000 0.000 Y CGB7 n/a
28 TRCN0000242640 CTCCTACGCCGTGGCTCTCAG pLKO_005 1648 CDS 100% 0.000 0.000 Y CGB2 n/a
29 TRCN0000242877 GCAACTACCGCGATGTGCGCT pLKO_005 1578 CDS 100% 0.000 0.000 Y CGB1 n/a
30 TRCN0000083466 GCGCTTCGAGTCCATCCGGCT pLKO.1 1594 CDS 100% 0.000 0.000 Y LHB n/a
31 TRCN0000242878 GGCTGTGGAGAAGGAGGGCTG pLKO_005 1456 CDS 100% 0.000 0.000 Y CGB1 n/a
32 TRCN0000369593 TGCCACCCTGGCTGTGGAGAA pLKO_005 1447 CDS 100% 0.000 0.000 Y CGB7 n/a
33 TRCN0000242636 GGCGGGACATGGGCATCCAAG pLKO_005 1394 CDS 100% 0.000 0.000 Y CGB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451784.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04608 pDONR223 100% 98.9% 98.1% None (many diffs) n/a
2 ccsbBroad304_04608 pLX_304 0% 98.9% 98.1% V5 (many diffs) n/a
3 TRCN0000469909 AAGTGTAGATATCACGCCGCTCGG pLX_317 77.4% 98.9% 98.1% V5 (many diffs) n/a
4 ccsbBroadEn_09361 pDONR223 100% 98.7% 97.5% None (many diffs) n/a
5 ccsbBroad304_09361 pLX_304 0% 98.7% 97.5% V5 (many diffs) n/a
6 TRCN0000467261 GATAACGAAGTGCTTTGCGACCGT pLX_317 83.3% 98.7% 97.5% V5 (many diffs) n/a
7 ccsbBroadEn_05987 pDONR223 100% 98.7% 98.1% None (many diffs) n/a
8 ccsbBroad304_05987 pLX_304 0% 98.7% 98.1% V5 (many diffs) n/a
9 TRCN0000479508 AGGTGCAAGGTGGAACATCCGCTA pLX_317 39.4% 98.7% 98.1% V5 (many diffs) n/a
10 ccsbBroadEn_13032 pDONR223 100% 63.9% 18.6% None (many diffs) n/a
11 ccsbBroad304_13032 pLX_304 0% 63.9% 18.6% V5 (many diffs) n/a
12 TRCN0000478100 ATGCTTCTTACTTAGTGCGTGGCG pLX_317 81.6% 63.9% 18.6% V5 (many diffs) n/a
Download CSV