Construct: ORF TRCN0000479563
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001242.1_s317c1
- Derived from:
- ccsbBroadEn_00332
- DNA Barcode:
- CGAGCGACGGGGTCGCACTCCCCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CCR3 (1232)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479563
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1232 | CCR3 | C-C motif chemokine receptor 3 | NM_001837.4 | 100% | 100% | |
| 2 | human | 1232 | CCR3 | C-C motif chemokine receptor 3 | NM_178329.3 | 100% | 100% | |
| 3 | human | 1232 | CCR3 | C-C motif chemokine receptor 3 | XM_006712960.3 | 100% | 100% | |
| 4 | human | 1232 | CCR3 | C-C motif chemokine receptor 3 | XM_011533335.2 | 100% | 100% | |
| 5 | human | 1232 | CCR3 | C-C motif chemokine receptor 3 | NM_001164680.2 | 95.1% | 95.1% | 1_54del |
| 6 | human | 1232 | CCR3 | C-C motif chemokine receptor 3 | NM_178328.1 | 94.4% | 94.4% | 1_63del |
| 7 | human | 1232 | CCR3 | C-C motif chemokine receptor 3 | XM_017005685.1 | 86.5% | 86.5% | 1_165del |
| 8 | human | 1232 | CCR3 | C-C motif chemokine receptor 3 | XM_017005686.1 | 86.5% | 86.5% | 1_165del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1131
- ORF length:
- 1065
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac aacctcacta gatacagttg agacctttgg taccacatcc tactatgatg 121 acgtgggcct gctctgtgaa aaagctgata ccagagcact gatggcccag tttgtgcccc 181 cgctgtactc cctggtgttc actgtgggcc tcttgggcaa tgtggtggtg gtgatgatcc 241 tcataaaata caggaggctc cgaattatga ccaacatcta cctgctcaac ctggccattt 301 cggacctgct cttcctcgtc acccttccat tctggatcca ctatgtcagg gggcataact 361 gggtttttgg ccatggcatg tgtaagctcc tctcagggtt ttatcacaca ggcttgtaca 421 gcgagatctt tttcataatc ctgctgacaa tcgacaggta cctggccatt gtccatgctg 481 tgtttgccct tcgagcccgg actgtcactt ttggtgtcat caccagcatc gtcacctggg 541 gcctggcagt gctagcagct cttcctgaat ttatcttcta tgagactgaa gagttgtttg 601 aagagactct ttgcagtgct ctttacccag aggatacagt atatagctgg aggcatttcc 661 acactctgag aatgaccatc ttctgtctcg ttctccctct gctcgttatg gccatctgct 721 acacaggaat catcaaaacg ctgctgaggt gccccagtaa aaaaaagtac aaggccatcc 781 ggctcatttt tgtcatcatG GCGGTGTTTT TCATTTTCTG GACACCCTAC AATGTGGCTA 841 TCCTTCTCTC TTCCTATCAA TCCATCTTAT TTGGAAATGA CTGTGAGCGG AGCAAGCATC 901 TGGACCTGGT CATGCTGGTG ACAGAGGTGA TCGCCTACTC CCACTGCTGC ATGAACCCGG 961 TGATCTACGC CTTTGTTGGA GAGAGGTTCC GGAAGTACCT GCGCCACTTC TTCCACAGGC 1021 ACTTGCTCAT GCACCTGGGC AGATACATCC CATTCCTTCC TAGTGAGAAG CTGGAAAGAA 1081 CCAGCTCTGT CTCTCCATCC ACAGCAGAGC CGGAACTCTC TATTGTGTTT TACCCAACTT 1141 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1201 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1261 CTTGTGGAAA GGACGACGAG CGACGGGGTC GCACTCCCCT ACGCGTTAAG TCgacaatca 1321 acctctggat tacaaaattt gtgaaagatt