Construct: ORF TRCN0000479743
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005350.1_s317c1
- Derived from:
- ccsbBroadEn_11079
- DNA Barcode:
- AGTCACTAGGTTGCTAGAGCATCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PTPRN (5798)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479743
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5798 | PTPRN | protein tyrosine phosphatas... | NM_001199764.2 | 66.4% | 66.4% | 1_894del |
| 2 | human | 5798 | PTPRN | protein tyrosine phosphatas... | NM_002846.4 | 60.3% | 60.3% | 1_1164del |
| 3 | human | 5798 | PTPRN | protein tyrosine phosphatas... | XM_017004609.2 | 60.3% | 60.3% | 1_1167del |
| 4 | human | 5798 | PTPRN | protein tyrosine phosphatas... | NM_001199763.2 | 57.4% | 57.3% | 1_1164del;1436_1437ins87 |
| 5 | human | 5798 | PTPRN | protein tyrosine phosphatas... | XM_017004610.2 | 57.3% | 57.2% | 1_1167del;1439_1440ins87 |
| 6 | human | 5798 | PTPRN | protein tyrosine phosphatas... | XM_011511566.2 | 52.9% | 52.9% | 1_1164del;1665_1666ins219 |
| 7 | human | 5798 | PTPRN | protein tyrosine phosphatas... | XM_017004611.2 | 52.8% | 52.8% | 1_1167del;1668_1669ins219 |
| 8 | human | 5798 | PTPRN | protein tyrosine phosphatas... | XM_017004612.2 | 49.9% | 49.8% | 1_1164del;1436_1437ins87;1578_1579ins219 |
| 9 | mouse | 19275 | Ptprn | protein tyrosine phosphatas... | XM_006496445.1 | 59.1% | 61% | (many diffs) |
| 10 | mouse | 19275 | Ptprn | protein tyrosine phosphatas... | XM_011238677.1 | 59.1% | 61% | (many diffs) |
| 11 | mouse | 19275 | Ptprn | protein tyrosine phosphatas... | XM_011238678.2 | 59.1% | 61% | (many diffs) |
| 12 | mouse | 19275 | Ptprn | protein tyrosine phosphatas... | XM_006496444.1 | 55% | 56.8% | (many diffs) |
| 13 | mouse | 19275 | Ptprn | protein tyrosine phosphatas... | NM_008985.2 | 53.5% | 55.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1839
- ORF length:
- 1773
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga ggggccggtg gagggcagag acacagcaga gcttccagcc cgcacatccc 121 ccatgcctgg acaccccact gccagcccta cctccagtga agtccagcag gtgccaagcc 181 ctgtctcctc tgagcctccc aaagctgcca gaccccctgt gacacctgtc ctgctagaga 241 agaaaagccc actgggccag agccagccca cggtggcagg acagccctca gcccgcccag 301 cagcagagga atatggctac atcgtcactg atcagaagcc cctgagcctg gctgcaggag 361 tgaagctgct ggagatcctg gctgagcatg tgcacatgtc ctcaggcagc ttcatcaaca 421 tcagtgtggt gggaccagcc ctcaccttcc gcatccggca caatgagcag aacctgtctt 481 tggctgatgt gacccaacaa gcagggctgg tgaagtctga actggaagca cagacagggc 541 tccaaatctt gcagacagga gtgggacaga gggaggaggc agctgcagtc cttccccaaa 601 ctgcgcacag cacctcaccc atgcgctcag tgctgctcac tctggtggcc ctggcaggtg 661 tggctgggct gctggtggct ctggctgtgg ctctgtgtgt gcggcagcat gcgcggcagc 721 aagacaagga gcgcctggca gccctggggc ctgagggggc ccatggtgac actacctttg 781 agtaccagga cctgtgccgc cagcacatgg ccacgaagtc cttgttcaac cgggcagagg 841 gtccaccgga gccttcacgg gtgagcagtg tgtcctccca gttcagcgac gcagcccagg 901 ccagccccag ctcccacagc agcaccccgt cctggtgcga ggagccggcc caagccaaca 961 tggacatctc cacgggacac atgattctgg catacatgga ggatcacctg cggaaccggg 1021 accgccttgc caaggagtgg caggccctct gtgcctacca agcagagcca aacacctgtg 1081 ccaccgcgca gggggagggc aacatcaaaa agaaccggca tcctgacttc ctgccctatg 1141 accatgcccg cataaaactg aaggtggaga gcagcccttc tcggagcgat tacatcaacg 1201 ccagccccat tattgagcat gaccctcgga tgccagccta catagccacg cagggcccgc 1261 tgtcccatac catcgcagac ttctggcaga tggtgtggga gagcggctgc accgtcatcg 1321 tcatgctgac cccgctggtg gaggatggtg tcaagcagtg tgaccgctac tggccagatg 1381 agggtgcctc cctctaccac gtatatgagg tgaacctggt gtcggagcac atctggtgcg 1441 aggactttct ggtgcggagc ttctacctga agaacgtgca gacccaggag acgcgcacgc 1501 tcacgcagtt ccacttccTC AGCTGGCCGG CAGAGGGCAC ACCGGCCTCC ACGCGGCCCC 1561 TGCTGGACTT CCGCAGGAAG GTGAACAAGT GCTACCGGGG CCGCTCCTGC CCCATCATCG 1621 TGCACTGCAG TGATGGTGCG GGGAGGACCG GCACCTACAT CCTCATCGAC ATGGTCCTGA 1681 ACCGCATGGC AAAAGGAGTG AAGGAGATTG ACATCGCTGC CACCCTGGAG CATGTCCGTG 1741 ACCAGCGGCC TGGCCTTGTC CGCTCTAAGG ACCAGTTTGA ATTTGCCCTG ACAGCCGTGG 1801 CGGAGGAAGT GAATGCCATC CTCAAGGCCC TGCCCCAGTG CCCAACTTTC TTGTACAAAG 1861 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1921 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1981 ACGAAGTCAC TAGGTTGCTA GAGCATCCAC GCGTTAAGTC gacaatcaac ctctggatta 2041 caaaatttgt gaaagatt