Transcript: Mouse XM_006496444.1

PREDICTED: Mus musculus protein tyrosine phosphatase, receptor type, N (Ptprn), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ptprn (19275)
Length:
3433
CDS:
58..2919

Additional Resources:

NCBI RefSeq record:
XM_006496444.1
NBCI Gene record:
Ptprn (19275)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496444.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220458 GCGGAGCTTCTACCTTAAGAA pLKO.1 2532 CDS 100% 5.625 7.875 N Ptprn n/a
2 TRCN0000220460 TGTCTGTTTGACCGCAGACTT pLKO.1 100 CDS 100% 0.495 0.693 N Ptprn n/a
3 TRCN0000339910 CAGCCCTTCTCGGAGTGATTA pLKO_005 2250 CDS 100% 13.200 9.240 N Ptprn n/a
4 TRCN0000339911 GGCCGAGGAGTATGGCTATAT pLKO_005 1380 CDS 100% 13.200 9.240 N Ptprn n/a
5 TRCN0000339979 CATTCGAGACAGCGGGATAAG pLKO_005 1786 CDS 100% 10.800 7.560 N Ptprn n/a
6 TRCN0000339978 GCCTACCACCTATAGACAAAG pLKO_005 3245 3UTR 100% 10.800 7.560 N Ptprn n/a
7 TRCN0000339980 TGGCTGCACTGTCATCGTTAT pLKO_005 2382 CDS 100% 10.800 7.560 N Ptprn n/a
8 TRCN0000220457 CCTTACCTCTTCCACCAGTTT pLKO.1 601 CDS 100% 4.950 3.465 N Ptprn n/a
9 TRCN0000220461 CTTATTGACATGGTCCTGAAT pLKO.1 2740 CDS 100% 4.950 3.465 N Ptprn n/a
10 TRCN0000220459 GCATACATGGAGGATCACCTT pLKO.1 2068 CDS 100% 2.640 1.848 N Ptprn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496444.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11079 pDONR223 100% 55% 56.8% None (many diffs) n/a
2 ccsbBroad304_11079 pLX_304 0% 55% 56.8% V5 (many diffs) n/a
3 TRCN0000479743 AGTCACTAGGTTGCTAGAGCATCC pLX_317 18.4% 55% 56.8% V5 (many diffs) n/a
Download CSV