Transcript: Human XM_017004612.2

PREDICTED: Homo sapiens protein tyrosine phosphatase receptor type N (PTPRN), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTPRN (5798)
Length:
3309
CDS:
73..2706

Additional Resources:

NCBI RefSeq record:
XM_017004612.2
NBCI Gene record:
PTPRN (5798)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004612.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378465 CTATGACCATGCCCGCATAAA pLKO_005 2001 CDS 100% 13.200 18.480 N PTPRN n/a
2 TRCN0000363094 GCCTCCCTCTACCACGTATAT pLKO_005 2251 CDS 100% 13.200 18.480 N PTPRN n/a
3 TRCN0000002887 GTTGTAAATGTTGGAGCTGAT pLKO.1 1204 CDS 100% 4.050 5.670 N PTPRN n/a
4 TRCN0000378469 ACTGCCTCCAAGGGCATATTT pLKO_005 811 CDS 100% 15.000 12.000 N PTPRN n/a
5 TRCN0000002884 CCTGTCCTGCTAGAGAAGAAA pLKO.1 1396 CDS 100% 5.625 3.938 N PTPRN n/a
6 TRCN0000002886 GCTCTAAGGACCAGTTTGAAT pLKO.1 2627 CDS 100% 5.625 3.938 N PTPRN n/a
7 TRCN0000002883 CATCCTGACTTCCTGCCCTAT pLKO.1 1984 CDS 100% 4.050 2.835 N PTPRN n/a
8 TRCN0000002885 GAAAGGACATGGGTAGCAATT pLKO.1 2943 3UTR 100% 10.800 6.480 N PTPRN n/a
9 TRCN0000220459 GCATACATGGAGGATCACCTT pLKO.1 1855 CDS 100% 2.640 1.848 N Ptprn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004612.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11079 pDONR223 100% 49.9% 49.8% None 1_1164del;1436_1437ins87;1578_1579ins219 n/a
2 ccsbBroad304_11079 pLX_304 0% 49.9% 49.8% V5 1_1164del;1436_1437ins87;1578_1579ins219 n/a
3 TRCN0000479743 AGTCACTAGGTTGCTAGAGCATCC pLX_317 18.4% 49.9% 49.8% V5 1_1164del;1436_1437ins87;1578_1579ins219 n/a
Download CSV