Construct: ORF TRCN0000479761
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006289.1_s317c1
- Derived from:
- ccsbBroadEn_04181
- DNA Barcode:
- TACTAGATATTTAGTTTGGGTCCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- IFT74 (80173)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479761
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 80173 | IFT74 | intraflagellar transport 74 | NM_001099224.2 | 100% | 100% | |
2 | human | 80173 | IFT74 | intraflagellar transport 74 | NM_001349928.2 | 65.4% | 63.2% | (many diffs) |
3 | human | 80173 | IFT74 | intraflagellar transport 74 | NM_001099222.2 | 61.2% | 59.1% | (many diffs) |
4 | human | 80173 | IFT74 | intraflagellar transport 74 | NM_001099223.2 | 61.2% | 59.1% | (many diffs) |
5 | human | 80173 | IFT74 | intraflagellar transport 74 | NM_025103.4 | 61.2% | 59.1% | (many diffs) |
6 | human | 80173 | IFT74 | intraflagellar transport 74 | XM_017015164.1 | 26.1% | 23.8% | (many diffs) |
7 | human | 80173 | IFT74 | intraflagellar transport 74 | XM_011518036.2 | 24.4% | 22.3% | (many diffs) |
8 | human | 80173 | IFT74 | intraflagellar transport 74 | XM_017015163.1 | 24.4% | 22.3% | (many diffs) |
9 | mouse | 67694 | Ift74 | intraflagellar transport 74 | NM_001290568.1 | 83.7% | 81.6% | (many diffs) |
10 | mouse | 67694 | Ift74 | intraflagellar transport 74 | XM_011240598.2 | 57.2% | 57.1% | (many diffs) |
11 | mouse | 67694 | Ift74 | intraflagellar transport 74 | NM_026319.3 | 53.9% | 53.8% | (many diffs) |
12 | mouse | 67694 | Ift74 | intraflagellar transport 74 | XM_006503324.3 | 53.9% | 53.8% | (many diffs) |
13 | mouse | 67694 | Ift74 | intraflagellar transport 74 | XM_006503326.2 | 53.9% | 53.8% | (many diffs) |
14 | mouse | 67694 | Ift74 | intraflagellar transport 74 | XM_011240597.2 | 53.9% | 53.8% | (many diffs) |
15 | mouse | 67694 | Ift74 | intraflagellar transport 74 | XM_006503327.3 | 49.6% | 48.2% | (many diffs) |
16 | mouse | 67694 | Ift74 | intraflagellar transport 74 | XM_006503328.3 | 49.6% | 49.1% | (many diffs) |
17 | mouse | 67694 | Ift74 | intraflagellar transport 74 | XR_001784189.1 | 42.1% | (many diffs) | |
18 | mouse | 67694 | Ift74 | intraflagellar transport 74 | XM_006503329.2 | 36.4% | 36% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1185
- ORF length:
- 1116
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggccagcaat cacaaatctt cagcagctcg ccctgtttca agaggtggag 121 ttgggttaac aggaaggcct ccttctggga tacgacccct atcaggaaat attcgagtgg 181 caactgcaat gccacctggg acagcaagac caggttctcg tggttgtccc atagggactg 241 gtggagttct gtcttctcaa atcaaagttg cccatcgccc tgtaacacaa caaggtttga 301 ctggaatgaa aactgggacg aaaggtcccc agaggcaaat tttagacaaa tcttactatc 361 ttgggcttct tagaagtaaa ataagtgaac ttacaactga agttaataaa cttcagaagg 421 gaatagaaat gtacaatcaa gagaattcag tatatttgtc atatgaaaag agggctgaga 481 ctttagctgt tgagataaaa gagcttcaag gacaactagc agactacaac atgttggtag 541 ataaacttaa taccaacact gaaatggaag aagtaatgaa tgattacaat atgcttaaag 601 ctcaaaatga tcgagaaaca caaagtttgg atgtcatatt tactgaaaga caagcgaaag 661 aaaaacaaat cagaagtgtc gaagaagaaa ttgaacagga aaaacaagca acagatgaca 721 ttatcaaaaa tatgtctttt gaaaaccaag tcaagtacct agagatgaaa accacaaatg 781 agaaactgtt acaggaatta gatacacttc aacaacaatt ggattcacag aacatgaaaa 841 aagagagcct ggaagcagaa atagctcact cCCAGGTGAA ACAGGAGGCG GTATTGCTGC 901 ATGAAAAACT TTATGAGTTG GAGTCCCATC GAGATCAAAT GATTGCAGAA GACAAAAGCA 961 TAGGATCTCC AATGGAAGAG AGAGAGAAAT TACTTAAGCA GATTAAAGAT GATAATCAGG 1021 AAATAGCCAG CATGGAAAGA CAGTTAACAG ATACAAAAGA AAAGATAAAT CAGTTTATTG 1081 AAGAAATTAG ACAACTTGAC ATGGATTTAG AGGAACACCA AGATCCTACC AACTATGGAT 1141 GGAAAATACT TGAAAAAAAT ACAGGAAGTT TCAAAAAGCA AGTTTTGCCA ACTTTCTTGT 1201 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1261 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1321 GAAAGGACGA TACTAGATAT TTAGTTTGGG TCCCACGCGT TAAGTCgaca atcaacctct 1381 ggattacaaa atttgtgaaa gatt