Transcript: Human XM_017015163.1

PREDICTED: Homo sapiens intraflagellar transport 74 (IFT74), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IFT74 (80173)
Length:
4874
CDS:
342..1481

Additional Resources:

NCBI RefSeq record:
XM_017015163.1
NBCI Gene record:
IFT74 (80173)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015163.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128272 GACAACTGATCTGGAGATATA pLKO.1 1109 CDS 100% 13.200 9.240 N IFT74 n/a
2 TRCN0000312500 GACAACTGATCTGGAGATATA pLKO_005 1109 CDS 100% 13.200 9.240 N IFT74 n/a
3 TRCN0000130561 GAGAGTGATTACCAGCCAATT pLKO.1 1383 CDS 100% 10.800 7.560 N IFT74 n/a
4 TRCN0000129758 CAAATCAGAAGTGTCGAAGAA pLKO.1 276 5UTR 100% 4.950 3.465 N IFT74 n/a
5 TRCN0000312499 CAAATCAGAAGTGTCGAAGAA pLKO_005 276 5UTR 100% 4.950 3.465 N IFT74 n/a
6 TRCN0000129251 CTGAAACGAAAGGCACAGATA pLKO.1 825 CDS 100% 4.950 3.465 N IFT74 n/a
7 TRCN0000312438 CTGAAACGAAAGGCACAGATA pLKO_005 825 CDS 100% 4.950 3.465 N IFT74 n/a
8 TRCN0000128802 CCAAGGTGAAATGAACCAGAA pLKO.1 728 CDS 100% 4.050 2.835 N IFT74 n/a
9 TRCN0000113228 CGAGATCAAATGATTGCAGAA pLKO.1 540 CDS 100% 4.050 2.835 N Ift74 n/a
10 TRCN0000288259 CGAGATCAAATGATTGCAGAA pLKO_005 540 CDS 100% 4.050 2.835 N Ift74 n/a
11 TRCN0000128529 CGAAGAAGAAATTGAACAGGA pLKO.1 290 5UTR 100% 2.640 1.584 N IFT74 n/a
12 TRCN0000162795 CTTCCAAAGTGCTGGGATTAT pLKO.1 202 5UTR 100% 13.200 6.600 Y SLC48A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015163.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04181 pDONR223 100% 24.4% 22.3% None (many diffs) n/a
2 ccsbBroad304_04181 pLX_304 0% 24.4% 22.3% V5 (many diffs) n/a
3 TRCN0000479761 TACTAGATATTTAGTTTGGGTCCC pLX_317 28.4% 24.4% 22.3% V5 (many diffs) n/a
Download CSV