Transcript: Mouse XM_011240598.2

PREDICTED: Mus musculus intraflagellar transport 74 (Ift74), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ift74 (67694)
Length:
2048
CDS:
233..1930

Additional Resources:

NCBI RefSeq record:
XM_011240598.2
NBCI Gene record:
Ift74 (67694)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240598.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113229 GAGGCTGTATTGCTGTATGAA pLKO.1 1049 CDS 100% 5.625 7.875 N Ift74 n/a
2 TRCN0000288198 GAGGCTGTATTGCTGTATGAA pLKO_005 1049 CDS 100% 5.625 7.875 N Ift74 n/a
3 TRCN0000113228 CGAGATCAAATGATTGCAGAA pLKO.1 1094 CDS 100% 4.050 3.240 N Ift74 n/a
4 TRCN0000288259 CGAGATCAAATGATTGCAGAA pLKO_005 1094 CDS 100% 4.050 3.240 N Ift74 n/a
5 TRCN0000113227 GCCAGCATCATCACACTGTTA pLKO.1 1403 CDS 100% 4.950 3.465 N Ift74 n/a
6 TRCN0000288258 GCCAGCATCATCACACTGTTA pLKO_005 1403 CDS 100% 4.950 3.465 N Ift74 n/a
7 TRCN0000113226 CCTCAGATTATGATACCCTTA pLKO.1 1800 CDS 100% 4.050 2.835 N Ift74 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240598.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04181 pDONR223 100% 57.2% 57.1% None (many diffs) n/a
2 ccsbBroad304_04181 pLX_304 0% 57.2% 57.1% V5 (many diffs) n/a
3 TRCN0000479761 TACTAGATATTTAGTTTGGGTCCC pLX_317 28.4% 57.2% 57.1% V5 (many diffs) n/a
Download CSV