Construct: ORF TRCN0000479849
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004395.1_s317c1
- Derived from:
- ccsbBroadEn_12515
- DNA Barcode:
- GGGTGACAACTCTGGCGGTCGGCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MPPE1 (65258)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479849
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_011525732.2 | 99.9% | 99.7% | 905G>T |
| 2 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_017025930.2 | 99.6% | 99.4% | 676_677insAGC;902G>T |
| 3 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_017025931.1 | 87.2% | 86.2% | (many diffs) |
| 4 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_006722348.2 | 86.8% | 82.1% | (many diffs) |
| 5 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_006722340.3 | 85.7% | 84.8% | (many diffs) |
| 6 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_006722341.4 | 85.7% | 84.8% | (many diffs) |
| 7 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_006722342.4 | 85.7% | 84.8% | (many diffs) |
| 8 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_006722343.3 | 85.7% | 84.8% | (many diffs) |
| 9 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_006722345.4 | 85.7% | 84.8% | (many diffs) |
| 10 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_011525731.3 | 85.7% | 84.8% | (many diffs) |
| 11 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_017025920.2 | 85.7% | 84.8% | (many diffs) |
| 12 | human | 65258 | MPPE1 | metallophosphoesterase 1 | NM_023075.6 | 85.4% | 84.6% | (many diffs) |
| 13 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_006722346.3 | 85.4% | 84.6% | (many diffs) |
| 14 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_017025922.2 | 85.4% | 84.6% | (many diffs) |
| 15 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_017025923.2 | 85.4% | 84.6% | (many diffs) |
| 16 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_017025924.2 | 85.4% | 84.6% | (many diffs) |
| 17 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_017025925.1 | 85.4% | 84.6% | (many diffs) |
| 18 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_017025926.2 | 85.4% | 84.6% | (many diffs) |
| 19 | human | 65258 | MPPE1 | metallophosphoesterase 1 | NM_001330563.2 | 79.9% | 79% | (many diffs) |
| 20 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_017025927.2 | 79.9% | 79% | (many diffs) |
| 21 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_017025928.1 | 79.9% | 79% | (many diffs) |
| 22 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_017025929.2 | 79.9% | 79% | (many diffs) |
| 23 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_011525734.2 | 76.1% | 66.1% | (many diffs) |
| 24 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_024451237.1 | 76.1% | 66.1% | (many diffs) |
| 25 | human | 65258 | MPPE1 | metallophosphoesterase 1 | NM_001242904.2 | 69.6% | 68.7% | (many diffs) |
| 26 | human | 65258 | MPPE1 | metallophosphoesterase 1 | NM_001319154.2 | 69.6% | 68.7% | (many diffs) |
| 27 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XR_935068.3 | 65.2% | (many diffs) | |
| 28 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XR_001753265.2 | 57% | (many diffs) | |
| 29 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XR_002958183.1 | 53% | 1_175del;1080G>T;1199_1926del | |
| 30 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XR_001753263.2 | 50.9% | (many diffs) | |
| 31 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XR_002958184.1 | 47.8% | (many diffs) | |
| 32 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XR_001753264.2 | 45.4% | (many diffs) | |
| 33 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XR_001753261.1 | 38.6% | (many diffs) | |
| 34 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XR_001753262.2 | 35% | (many diffs) | |
| 35 | human | 65258 | MPPE1 | metallophosphoesterase 1 | NR_040243.2 | 29.2% | 1_316del;1221G>T;1340_3498del | |
| 36 | human | 65258 | MPPE1 | metallophosphoesterase 1 | NR_040241.2 | 29.1% | (many diffs) | |
| 37 | human | 65258 | MPPE1 | metallophosphoesterase 1 | NR_040242.4 | 28.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1089
- ORF length:
- 1023
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gatgatcgaa ttggggtttg gaagacagaa ttttcatcca ttaaagagga 121 agagttcatt gctgttgaaa ctcatagctg ttgtctttgc tgtgcttcta ttttgtgaat 181 ttttaatcta ttacttagcg atctttcagt gtaattggcc tgaagtgaaa accacagcct 241 ctgatggtga acagaccaca cgtgagcctg tgctcaaagc catgtttttg gctgacaccc 301 atttgcttgg ggaattccta ggccactggc tggacaaatt acgaagggaa tggcagatgg 361 agagagcgtt ccagacagct ctgtggttgc tgcagccgga agtcgtcttc atcctggggg 421 atatctttga tgaagggaag tggagcaccc ctgaggcctg ggcggatgat gtggagcggt 481 ttcagaaaat gttcagacac ccaagtcatg tacagctgaa ggtagttgct ggaaaccatg 541 acattggctt ccattatgag atgaacacat acaaagtaga acgctttgag aaagtgttca 601 gctctgaaag actgttttct tggaaaggca ttaactttgt gatggtcaac agcgtggcgc 661 tgaacgggga tggctgtggc atctgctctg aaacagaagc agagctcatt gaagtttctc 721 acagactgaa ctgctcccga gagcaggcac gtggctccag ccggtgtgga cctgggcctc 781 tgctgcccac gtctgcccct gtcctcctgc agcattaTCC TCTGTATCGG AGAAGTGATG 841 CTAACTGTTC TGGGGAAGAC GCTGCTCCTG CAGAGGAAAG GGACATCCCA TTTAAGGAGA 901 ACTATGACGT GCTTTCACGG GAGGCATCAC AAAAGCTGCT GTGGTGGCTC CAGCCGCGCC 961 TGGTTCTCAT TGGCCACACG CACAGCGCCT GCGAGGTGCA CCACGGGGGC CGAGTCCCCG 1021 AGCTCAGCGT CCCATCTTTC AGTTGGAGGA ACAGAAACAA CCCCAGTTTC ATCATGGGAA 1081 CAGATGCTTA CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1141 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1201 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAGGGTGA CAACTCTGGC GGTCGGCCAC 1261 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt