Transcript: Human XM_006722348.2

PREDICTED: Homo sapiens metallophosphoesterase 1 (MPPE1), transcript variant X26, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MPPE1 (65258)
Length:
1292
CDS:
350..1258

Additional Resources:

NCBI RefSeq record:
XM_006722348.2
NBCI Gene record:
MPPE1 (65258)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006722348.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048965 CCTGTGCTCAAAGCCATGTTT pLKO.1 551 CDS 100% 5.625 3.938 N MPPE1 n/a
2 TRCN0000048966 CATCCCATTTAAGGAGAACTA pLKO.1 1168 CDS 100% 4.950 3.465 N MPPE1 n/a
3 TRCN0000048964 CCATTATGAGATGAACACATA pLKO.1 835 CDS 100% 4.950 3.465 N MPPE1 n/a
4 TRCN0000048967 CTGTTGAAACTCATAGCTGTT pLKO.1 416 CDS 100% 4.050 2.835 N MPPE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006722348.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12515 pDONR223 100% 86.8% 82.1% None (many diffs) n/a
2 ccsbBroad304_12515 pLX_304 0% 86.8% 82.1% V5 (many diffs) n/a
3 TRCN0000479849 GGGTGACAACTCTGGCGGTCGGCC pLX_317 27% 86.8% 82.1% V5 (many diffs) n/a
4 ccsbBroadEn_12514 pDONR223 100% 77.9% 65.7% None (many diffs) n/a
5 ccsbBroad304_12514 pLX_304 0% 77.9% 65.7% V5 (many diffs) n/a
6 TRCN0000471312 AAGGGTACCAATCTTAAGTGACCA pLX_317 37.9% 77.9% 65.7% V5 (many diffs) n/a
Download CSV