Transcript: Human XR_002958184.1

PREDICTED: Homo sapiens metallophosphoesterase 1 (MPPE1), transcript variant X24, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MPPE1 (65258)
Length:
1924
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002958184.1
NBCI Gene record:
MPPE1 (65258)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002958184.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048965 CCTGTGCTCAAAGCCATGTTT pLKO.1 444 3UTR 100% 5.625 3.938 N MPPE1 n/a
2 TRCN0000048966 CATCCCATTTAAGGAGAACTA pLKO.1 992 3UTR 100% 4.950 3.465 N MPPE1 n/a
3 TRCN0000048964 CCATTATGAGATGAACACATA pLKO.1 728 3UTR 100% 4.950 3.465 N MPPE1 n/a
4 TRCN0000048963 GTACTCTACAACAAATCTGTT pLKO.1 1725 3UTR 100% 4.950 3.465 N MPPE1 n/a
5 TRCN0000048967 CTGTTGAAACTCATAGCTGTT pLKO.1 309 3UTR 100% 4.050 2.835 N MPPE1 n/a
6 TRCN0000195953 CCCATCTTTCAGTTGGAGGAA pLKO.1 1139 3UTR 100% 2.640 1.848 N Mppe1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002958184.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12514 pDONR223 100% 51.9% None (many diffs) n/a
2 ccsbBroad304_12514 pLX_304 0% 51.9% V5 (many diffs) n/a
3 TRCN0000471312 AAGGGTACCAATCTTAAGTGACCA pLX_317 37.9% 51.9% V5 (many diffs) n/a
4 ccsbBroadEn_12515 pDONR223 100% 47.8% None (many diffs) n/a
5 ccsbBroad304_12515 pLX_304 0% 47.8% V5 (many diffs) n/a
6 TRCN0000479849 GGGTGACAACTCTGGCGGTCGGCC pLX_317 27% 47.8% V5 (many diffs) n/a
Download CSV