Transcript: Human NM_001330563.2

Homo sapiens metallophosphoesterase 1 (MPPE1), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-08-31
Taxon:
Homo sapiens (human)
Gene:
MPPE1 (65258)
Length:
3264
CDS:
317..1441

Additional Resources:

NCBI RefSeq record:
NM_001330563.2
NBCI Gene record:
MPPE1 (65258)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330563.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048965 CCTGTGCTCAAAGCCATGTTT pLKO.1 518 CDS 100% 5.625 3.938 N MPPE1 n/a
2 TRCN0000048966 CATCCCATTTAAGGAGAACTA pLKO.1 1066 CDS 100% 4.950 3.465 N MPPE1 n/a
3 TRCN0000048964 CCATTATGAGATGAACACATA pLKO.1 802 CDS 100% 4.950 3.465 N MPPE1 n/a
4 TRCN0000048963 GTACTCTACAACAAATCTGTT pLKO.1 1634 3UTR 100% 4.950 3.465 N MPPE1 n/a
5 TRCN0000048967 CTGTTGAAACTCATAGCTGTT pLKO.1 383 CDS 100% 4.050 2.835 N MPPE1 n/a
6 TRCN0000195953 CCCATCTTTCAGTTGGAGGAA pLKO.1 1213 CDS 100% 2.640 1.848 N Mppe1 n/a
7 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 1915 3UTR 100% 4.950 2.475 Y CFLAR n/a
8 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 1915 3UTR 100% 4.950 2.475 Y C19orf31 n/a
9 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 1954 3UTR 100% 4.050 2.025 Y P3H4 n/a
10 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 1954 3UTR 100% 4.050 2.025 Y ORAI2 n/a
11 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 1954 3UTR 100% 4.050 2.025 Y P3H4 n/a
12 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 1913 3UTR 100% 4.950 2.475 Y ERN2 n/a
13 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 1913 3UTR 100% 4.950 2.475 Y P3H4 n/a
14 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 1913 3UTR 100% 4.950 2.475 Y P3H4 n/a
15 TRCN0000140536 GCCAACATGGTGAAACCTCAT pLKO.1 1988 3UTR 100% 4.050 2.025 Y TLCD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330563.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12514 pDONR223 100% 89% 89% None 677_799del n/a
2 ccsbBroad304_12514 pLX_304 0% 89% 89% V5 677_799del n/a
3 TRCN0000471312 AAGGGTACCAATCTTAAGTGACCA pLX_317 37.9% 89% 89% V5 677_799del n/a
4 ccsbBroadEn_12515 pDONR223 100% 79.9% 79% None (many diffs) n/a
5 ccsbBroad304_12515 pLX_304 0% 79.9% 79% V5 (many diffs) n/a
6 TRCN0000479849 GGGTGACAACTCTGGCGGTCGGCC pLX_317 27% 79.9% 79% V5 (many diffs) n/a
Download CSV