Construct: ORF TRCN0000479874
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005240.1_s317c1
- Derived from:
- ccsbBroadEn_04052
- DNA Barcode:
- TAGACTCACTTTTCAGATGCCCAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NDUFAF5 (79133)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479874
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 79133 | NDUFAF5 | NADH:ubiquinone oxidoreduct... | NM_001039375.3 | 100% | 100% | |
| 2 | human | 79133 | NDUFAF5 | NADH:ubiquinone oxidoreduct... | NM_024120.5 | 88.2% | 86.3% | 325_326insAGCTTCAGTTATTCCATTGC;375_478del |
| 3 | human | 79133 | NDUFAF5 | NADH:ubiquinone oxidoreduct... | XR_937140.2 | 72.7% | (many diffs) | |
| 4 | human | 79133 | NDUFAF5 | NADH:ubiquinone oxidoreduct... | XM_011529342.2 | 67.4% | 59.3% | (many diffs) |
| 5 | human | 79133 | NDUFAF5 | NADH:ubiquinone oxidoreduct... | NM_001352408.1 | 59.3% | 55.4% | (many diffs) |
| 6 | human | 79133 | NDUFAF5 | NADH:ubiquinone oxidoreduct... | NM_001352403.2 | 59.3% | 59.3% | 0_1ins387 |
| 7 | human | 79133 | NDUFAF5 | NADH:ubiquinone oxidoreduct... | XM_006723624.2 | 59.3% | 59.3% | 0_1ins387 |
| 8 | human | 79133 | NDUFAF5 | NADH:ubiquinone oxidoreduct... | XM_024451999.1 | 59.3% | 59.3% | 0_1ins387 |
| 9 | human | 79133 | NDUFAF5 | NADH:ubiquinone oxidoreduct... | NM_001352406.2 | 49.8% | 49.8% | 0_1ins477 |
| 10 | human | 79133 | NDUFAF5 | NADH:ubiquinone oxidoreduct... | NM_001352407.2 | 49.8% | 49.8% | 0_1ins477 |
| 11 | human | 79133 | NDUFAF5 | NADH:ubiquinone oxidoreduct... | XR_430269.3 | 19.2% | (many diffs) | |
| 12 | human | 79133 | NDUFAF5 | NADH:ubiquinone oxidoreduct... | XR_001754396.1 | 17.4% | 1_43del;735_832del;1093_5465del | |
| 13 | human | 79133 | NDUFAF5 | NADH:ubiquinone oxidoreduct... | NR_147979.2 | 17% | (many diffs) | |
| 14 | human | 79133 | NDUFAF5 | NADH:ubiquinone oxidoreduct... | NR_147980.2 | 17% | (many diffs) | |
| 15 | human | 79133 | NDUFAF5 | NADH:ubiquinone oxidoreduct... | NR_147983.2 | 16.9% | (many diffs) | |
| 16 | human | 79133 | NDUFAF5 | NADH:ubiquinone oxidoreduct... | NR_147978.2 | 16.8% | (many diffs) | |
| 17 | human | 79133 | NDUFAF5 | NADH:ubiquinone oxidoreduct... | NR_029377.2 | 16.7% | (many diffs) | |
| 18 | mouse | 69487 | Ndufaf5 | NADH:ubiquinone oxidoreduct... | XM_011239768.2 | 84% | 83.5% | (many diffs) |
| 19 | mouse | 69487 | Ndufaf5 | NADH:ubiquinone oxidoreduct... | NM_027093.4 | 74.1% | 74.2% | (many diffs) |
| 20 | mouse | 69487 | Ndufaf5 | NADH:ubiquinone oxidoreduct... | XM_030252052.1 | 52.2% | 53.9% | (many diffs) |
| 21 | mouse | 69487 | Ndufaf5 | NADH:ubiquinone oxidoreduct... | XM_030252053.1 | 43.7% | 45.1% | (many diffs) |
| 22 | mouse | 69487 | Ndufaf5 | NADH:ubiquinone oxidoreduct... | XR_003953715.1 | 4.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1017
- ORF length:
- 951
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct gcggccggca gggctctggc gcttatgtcg gcgaccttgg gcggcgaggg 121 tcccagcgga gaatcttggc cgtagggaag tcacctctgg tgtctctccc cgcggtagca 181 cctcgcccag aaccctgaat attttcgacc gggatttgaa aaggaaacag aagaactggg 241 cagcccggca gcccgagccg accaaatttg actacctgaa ggaggaggtt ggaagtcgga 301 tcgcagaccg tgtatatgac atacccagaa atttccccct tgctttggat cttggttgtg 361 gaagaggtta cattgcacaa tatttgaata agcttcagtt attccattgc aggaaactat 421 tggaaagttt ttccaagctg acattgcaga aaatgctttg tttgcattgg gtgaatgacc 481 ttcctagagc acttgagcag attcattata ttttaaaacc agatggagtg tttatcggtg 541 caatgtttgg aggcgacaca ctctatgaac ttcggtgttc cttacagtta gcggaaacgg 601 aaagggaagg aggattttct ccacacattt ctcctttcac tgctgtcaat gacctgggac 661 atctgcttgg gagagctggc tttaatactc tgactgtgga cactgatgaa attcaagtta 721 actaTCCTGG AATGTTTGAA TTGATGGAAG ATTTACAAGG TATGGGTGAG AGTAACTGTG 781 CTTGGAATAG AAAAGCCCTG CTGCATCGAG ACACAATGCT GGCAGCTGCG GCAGTGTACA 841 GAGAAATGTA CAGAAATGAA GATGGTTCAG TACCTGCTAC ATACCAGATC TATTACATGA 901 TAGGATGGAA ATATCATGAG TCACAGGCAA GACCAGCTGA AAGAGGTTCC GCAACTGTGT 961 CATTTGGAGA GCTAGGAAAA ATAAACAACC TTATGCCACC GGGGAAAAAA TCACAATACC 1021 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 1081 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1141 ATATATCTTG TGGAAAGGAC GATAGACTCA CTTTTCAGAT GCCCATACGC GTTAAGTCga 1201 caatcaacct ctggattaca aaatttgtga aagatt