Transcript: Human NR_147979.2

Homo sapiens NADH:ubiquinone oxidoreductase complex assembly factor 5 (NDUFAF5), transcript variant 9, non-coding RNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
NDUFAF5 (79133)
Length:
5567
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_147979.2
NBCI Gene record:
NDUFAF5 (79133)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_147979.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160192 CATCAGAAATGGATAGCTTTA pLKO.1 1232 3UTR 100% 10.800 15.120 N NDUFAF5 n/a
2 TRCN0000159852 GAAGAGGTTACATTGCACAAT pLKO.1 337 3UTR 100% 4.950 6.930 N NDUFAF5 n/a
3 TRCN0000161362 GCAGACCGTGTATATGACATA pLKO.1 279 3UTR 100% 4.950 6.930 N NDUFAF5 n/a
4 TRCN0000162496 CACTCTATGAACTTCGGTGTT pLKO.1 639 3UTR 100% 4.050 5.670 N NDUFAF5 n/a
5 TRCN0000160102 CTTTATTAAATCCCTCCTCAA pLKO.1 1614 3UTR 100% 4.050 5.670 N NDUFAF5 n/a
6 TRCN0000163287 GCCGACCAAATTTGACTACCT pLKO.1 233 3UTR 100% 2.640 3.696 N NDUFAF5 n/a
7 TRCN0000162305 CGTGTATATGACATACCCAGA pLKO.1 285 3UTR 100% 2.160 3.024 N NDUFAF5 n/a
8 TRCN0000158970 GAGGTTACATTGCACAATATT pLKO.1 340 3UTR 100% 15.000 10.500 N NDUFAF5 n/a
9 TRCN0000162482 CCTGCTACATACCAGATCTAT pLKO.1 1051 3UTR 100% 5.625 3.938 N NDUFAF5 n/a
10 TRCN0000159719 GTTTCTGTTCTCATAAGGATA pLKO.1 1371 3UTR 100% 4.950 3.465 N NDUFAF5 n/a
11 TRCN0000158938 GTTAGCAGTTTAAGTTTGCAT pLKO.1 527 3UTR 100% 3.000 2.100 N NDUFAF5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_147979.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04052 pDONR223 100% 17% None (many diffs) n/a
2 ccsbBroad304_04052 pLX_304 0% 17% V5 (many diffs) n/a
3 TRCN0000479874 TAGACTCACTTTTCAGATGCCCAT pLX_317 31.2% 17% V5 (many diffs) n/a
4 ccsbBroadEn_12547 pDONR223 100% 8.5% None 1_622del;837_934del;1195_5567del n/a
5 ccsbBroad304_12547 pLX_304 0% 8.5% V5 1_622del;837_934del;1195_5567del n/a
6 TRCN0000473995 CGCGATTGGAGGAAGGCCAGTAGC pLX_317 100% 8.5% V5 1_622del;837_934del;1195_5567del n/a
Download CSV