Construct: ORF TRCN0000479965
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016151.1_s317c1
- Derived from:
- ccsbBroadEn_13727
- DNA Barcode:
- TGGTTTCTCTAACACGCTCCACAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LOC646358 (646358)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479965
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 79982 | DNAJB14 | DnaJ heat shock protein fam... | XM_017008628.2 | 41.9% | 40.2% | (many diffs) |
2 | human | 79982 | DNAJB14 | DnaJ heat shock protein fam... | XM_011532262.3 | 41.4% | 39.7% | (many diffs) |
3 | human | 79982 | DNAJB14 | DnaJ heat shock protein fam... | NM_001278310.2 | 39.1% | 37.5% | (many diffs) |
4 | human | 79982 | DNAJB14 | DnaJ heat shock protein fam... | NM_001031723.4 | 32.1% | 30.8% | (many diffs) |
5 | human | 79982 | DNAJB14 | DnaJ heat shock protein fam... | XR_001741327.1 | 6% | (many diffs) | |
6 | mouse | 70604 | Dnajb14 | DnaJ heat shock protein fam... | XM_006502056.2 | 34.6% | 35.8% | (many diffs) |
7 | mouse | 70604 | Dnajb14 | DnaJ heat shock protein fam... | XM_006502055.2 | 32.8% | 34% | (many diffs) |
8 | mouse | 70604 | Dnajb14 | DnaJ heat shock protein fam... | NM_001033155.1 | 28.4% | 29.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 447
- ORF length:
- 378
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gcccataatt gtattgatcc tcgtgtcatt attaagccag ttgatggtct 121 gtaatcctcc ttattccttc tatcccagat ctggaacagg gcaaactatt aaaacgcaga 181 cagaaaactt gggtggtgtt tattatgtca gcaaggactt taaaaatgaa tataaaggaa 241 tgttattaca aaaggcagaa aagagtgtgg aggaagatta tgtgactaat attcGAAATA 301 ACTGCTGGAA AGAAAGACAA CAAAAAACAG ATATGCAGTA TGCAGCAAAA GTATACCGTG 361 GTGATCGACT CCGAAGGAAG TCAGATGCCT TGAGCATGGA CAACTGTAAA GAATTAGAGC 421 GGCTTACCGG TCTTTATAAA GGAGGATTGC CAACTTTCTT GTACAAAGTG GTTGATATCG 481 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 541 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GATGGTTTCT 601 CTAACACGCT CCACACACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 661 aagatt