Transcript: Human NM_001031723.4

Homo sapiens DnaJ heat shock protein family (Hsp40) member B14 (DNAJB14), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
DNAJB14 (79982)
Length:
5967
CDS:
48..1187

Additional Resources:

NCBI RefSeq record:
NM_001031723.4
NBCI Gene record:
DNAJB14 (79982)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001031723.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000335945 AGCGGCTTACCAGTCTTTATA pLKO_005 1156 CDS 100% 15.000 21.000 N DNAJB14 n/a
2 TRCN0000335861 GCGATCAAAGCAAGCCTAATT pLKO_005 256 CDS 100% 13.200 18.480 N DNAJB14 n/a
3 TRCN0000151111 GTAAAGAATTAGAGCGGCTTA pLKO.1 1144 CDS 100% 4.050 5.670 N DNAJB14 n/a
4 TRCN0000154348 CGGGCAATGAAGAACAAGCAT pLKO.1 559 CDS 100% 3.000 2.400 N DNAJB14 n/a
5 TRCN0000335863 ATCCAGCTGATGCCCATAATT pLKO_005 798 CDS 100% 15.000 10.500 N DNAJB14 n/a
6 TRCN0000150653 GAGGTTGTGAAGCTGATATAA pLKO.1 616 CDS 100% 15.000 10.500 N DNAJB14 n/a
7 TRCN0000150360 CCTGAAATCTTGGACTGTTTA pLKO.1 1308 3UTR 100% 13.200 9.240 N DNAJB14 n/a
8 TRCN0000335860 CCTGAAATCTTGGACTGTTTA pLKO_005 1308 3UTR 100% 13.200 9.240 N DNAJB14 n/a
9 TRCN0000335864 GTGACTAATATTCGAAATAAC pLKO_005 1020 CDS 100% 13.200 9.240 N DNAJB14 n/a
10 TRCN0000152147 CGAAATAACTGCTGGAAAGAA pLKO.1 1032 CDS 100% 5.625 3.938 N DNAJB14 n/a
11 TRCN0000151414 GAAAGGATTATCACACCTGTA pLKO.1 1445 3UTR 100% 4.050 2.835 N DNAJB14 n/a
12 TRCN0000150558 GCTCCTTGTAAGTAAATCCAT pLKO.1 2370 3UTR 100% 3.000 2.100 N DNAJB14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001031723.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04159 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04159 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472243 TCTCTCTGACATTTTGCCTTCCTT pLX_317 39.2% 100% 100% V5 n/a
4 ccsbBroadEn_13727 pDONR223 100% 32.1% 30.8% None (many diffs) n/a
5 ccsbBroad304_13727 pLX_304 0% 32.1% 30.8% V5 (many diffs) n/a
6 TRCN0000479965 TGGTTTCTCTAACACGCTCCACAC pLX_317 40.6% 32.1% 30.8% V5 (many diffs) n/a
Download CSV