Construct: ORF TRCN0000480029
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003593.1_s317c1
- Derived from:
- ccsbBroadEn_02658
- DNA Barcode:
- ACGCACCCCAACCCGAGGACACGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PACSIN2 (11252)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480029
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 11252 | PACSIN2 | protein kinase C and casein... | NM_001184970.3 | 100% | 100% | |
2 | human | 11252 | PACSIN2 | protein kinase C and casein... | NM_007229.3 | 100% | 100% | |
3 | human | 11252 | PACSIN2 | protein kinase C and casein... | NM_001349969.1 | 99.5% | 99.5% | 907_912delGATGAA |
4 | human | 11252 | PACSIN2 | protein kinase C and casein... | NM_001349970.1 | 99.5% | 99.5% | 907_912delGATGAA |
5 | human | 11252 | PACSIN2 | protein kinase C and casein... | NM_001184971.1 | 91.5% | 91.5% | 1028_1029ins123 |
6 | human | 11252 | PACSIN2 | protein kinase C and casein... | NM_001349968.1 | 91.1% | 91.1% | 907_912delGATGAA;1034_1035ins123 |
7 | human | 11252 | PACSIN2 | protein kinase C and casein... | NM_001349971.1 | 91.1% | 91.1% | 907_912delGATGAA;1034_1035ins123 |
8 | human | 11252 | PACSIN2 | protein kinase C and casein... | NM_001349972.1 | 91.1% | 91.1% | 907_912delGATGAA;1034_1035ins123 |
9 | human | 11252 | PACSIN2 | protein kinase C and casein... | NM_001349973.1 | 91.1% | 91.1% | 907_912delGATGAA;1034_1035ins123 |
10 | human | 11252 | PACSIN2 | protein kinase C and casein... | NM_001349974.1 | 82.7% | 82.7% | 0_1ins123;784_789delGATGAA;911_912ins123 |
11 | mouse | 23970 | Pacsin2 | protein kinase C and casein... | NM_001159509.1 | 89% | 93.8% | (many diffs) |
12 | mouse | 23970 | Pacsin2 | protein kinase C and casein... | NM_001159510.1 | 89% | 93.8% | (many diffs) |
13 | mouse | 23970 | Pacsin2 | protein kinase C and casein... | NM_011862.3 | 89% | 93.8% | (many diffs) |
14 | mouse | 23970 | Pacsin2 | protein kinase C and casein... | XM_006520979.1 | 88.6% | 93.4% | (many diffs) |
15 | mouse | 23970 | Pacsin2 | protein kinase C and casein... | XM_006520980.3 | 88.6% | 93.4% | (many diffs) |
16 | mouse | 23970 | Pacsin2 | protein kinase C and casein... | XM_006520981.3 | 88.6% | 93.4% | (many diffs) |
17 | mouse | 23970 | Pacsin2 | protein kinase C and casein... | XM_006520982.1 | 88.6% | 93.4% | (many diffs) |
18 | mouse | 23970 | Pacsin2 | protein kinase C and casein... | XM_006520983.3 | 88.6% | 93.4% | (many diffs) |
19 | mouse | 23970 | Pacsin2 | protein kinase C and casein... | XM_011245633.2 | 88.6% | 93.4% | (many diffs) |
20 | mouse | 23970 | Pacsin2 | protein kinase C and casein... | XM_006520985.2 | 81.2% | 87% | (many diffs) |
21 | mouse | 23970 | Pacsin2 | protein kinase C and casein... | XM_006520984.1 | 80.9% | 86.6% | (many diffs) |
22 | mouse | 23970 | Pacsin2 | protein kinase C and casein... | XM_017316605.1 | 80.9% | 86.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1524
- ORF length:
- 1458
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc tgtcacatat gatgattccg ttggagtaga agtgtccagc gacagcttct 121 gggaggtcgg gaactacaag cggactgtga agcggatcga cgatggccac cgcctgtgca 181 gcgacctcat gaactgcctg catgagcggg cgcgcatcga gaaggcgtat gcgcagcagc 241 tcactgagtg ggcccggcgc tggaggcagc tcgtggagaa agggccccag tacgggaccg 301 tggagaaggc ctggatggcc ttcatgtccg aggcagagag ggtgagcgag ctgcacctcg 361 aggtgaaggc ctcactgatg aacgatgact tcgagaagat caagaactgg cagaaggaag 421 cctttcacaa gcagatgatg ggcggcttca aggagaccaa ggaagctgag gacggctttc 481 ggaaggcaca gaagccctgg gccaagaagc tgaaagaggt agaagcagca aagaaagccc 541 accatgcagc gtgcaaagag gagaagctgg ctatctcacg agaagccaac agcaaggcag 601 acccatccct caaccctgaa cagctcaaga aattgcaaga caaaatagaa aagtgcaagc 661 aagatgttct taagaccaaa gagaagtatg agaagtccct gaaggaactc gaccagggca 721 caccccagta catggagaac atggagcagg tgtttgagca gtgccagcag ttcgaggaga 781 aacgccttcg cttcttccgg gaggttctgc tggaggttca gaagcaccta gacctgtcca 841 atgtggctgg ctacaaagcc atttaccatg acctggagca gagcatcaga gcagctgatg 901 cagtggagga cctgaggtgg ttccgagcca atcacgggcc gggcatggcc atgaactggc 961 cgcagtttga ggagtggtcc gcagacctga atcgaaccct cagccggaga gagaagaaga 1021 aggccactga cggcgtcacc ctgacgggca tcaaccagac aggcgaccag tctctgccga 1081 gtaagcccag cagcaccctt aatgtcccga gcaaccccgc ccagtctgcg cagtcacagt 1141 ccagctacaa ccccTTCGAG GATGAGGACG ACACGGGCAG CACCGTCAGT GAGAAGGACG 1201 ACACTAAGGC CAAAAATGTG AGCAGCTACG AGAAGACCCA GAGCTATCCC ACCGACTGGT 1261 CAGACGATGA GTCTAACAAC CCCTTCTCCT CCACGGATGC CAATGGGGAC TCGAATCCAT 1321 TCGACGACGA CGCCACCTCG GGGACGGAAG TGCGAGTCCG GGCCCTGTAT GACTATGAGG 1381 GGCAGGAGCA TGATGAGCTG AGCTTCAAGG CTGGGGATGA GCTGACCAAG ATGGAGGACG 1441 AGGATGAGCA GGGCTGGTGC AAGGGACGCT TGGACAACGG GCAAGTTGGC CTATACCCGG 1501 CAAATTATGT GGAGGCGATC CAGTGCCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1561 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1621 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAA CGCACCCCAA 1681 CCCGAGGACA CGGACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1741 att