Transcript: Mouse XM_006520980.3

PREDICTED: Mus musculus protein kinase C and casein kinase substrate in neurons 2 (Pacsin2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pacsin2 (23970)
Length:
3222
CDS:
260..1726

Additional Resources:

NCBI RefSeq record:
XM_006520980.3
NBCI Gene record:
Pacsin2 (23970)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520980.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305725 GGTTGGTGCAAGGGACGTTTA pLKO_005 1652 CDS 100% 10.800 15.120 N Pacsin2 n/a
2 TRCN0000088733 CGGGTCATACTGATTCTTGTT pLKO.1 2067 3UTR 100% 4.950 3.960 N Pacsin2 n/a
3 TRCN0000324235 CGGGTCATACTGATTCTTGTT pLKO_005 2067 3UTR 100% 4.950 3.960 N Pacsin2 n/a
4 TRCN0000305666 TCCAATGTGGCTAGCTATAAA pLKO_005 1031 CDS 100% 15.000 10.500 N Pacsin2 n/a
5 TRCN0000305724 TGGTCTGATGATGAGTCTAAC pLKO_005 1457 CDS 100% 10.800 7.560 N Pacsin2 n/a
6 TRCN0000088737 CTAAAGACCAAGGACAAGTAT pLKO.1 863 CDS 100% 5.625 3.938 N Pacsin2 n/a
7 TRCN0000088735 CTGACCAAGATAGAGGATGAA pLKO.1 1622 CDS 100% 4.950 3.465 N Pacsin2 n/a
8 TRCN0000088734 GCAGTTACAGTCCAGCTACAA pLKO.1 1330 CDS 100% 4.950 3.465 N Pacsin2 n/a
9 TRCN0000088736 TCACTGATGAATGAAGACTTT pLKO.1 566 CDS 100% 4.950 3.465 N Pacsin2 n/a
10 TRCN0000324234 TCACTGATGAATGAAGACTTT pLKO_005 566 CDS 100% 4.950 3.465 N Pacsin2 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2879 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520980.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02658 pDONR223 100% 88.6% 93.4% None (many diffs) n/a
2 ccsbBroad304_02658 pLX_304 0% 88.6% 93.4% V5 (many diffs) n/a
3 TRCN0000480029 ACGCACCCCAACCCGAGGACACGG pLX_317 25.7% 88.6% 93.4% V5 (many diffs) n/a
Download CSV