Transcript: Human NM_001349972.1

Homo sapiens protein kinase C and casein kinase substrate in neurons 2 (PACSIN2), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
PACSIN2 (11252)
Length:
3113
CDS:
161..1504

Additional Resources:

NCBI RefSeq record:
NM_001349972.1
NBCI Gene record:
PACSIN2 (11252)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001349972.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037979 CGCTTGGACAACGGGCAAGTT pLKO.1 1445 CDS 100% 1.650 1.320 N PACSIN2 n/a
2 TRCN0000037983 TGGCCTATACCCGGCAAATTA pLKO.1 1465 CDS 100% 15.000 10.500 N PACSIN2 n/a
3 TRCN0000296005 TGGTCAGACGATGAGTCTAAC pLKO_005 1235 CDS 100% 10.800 7.560 N PACSIN2 n/a
4 TRCN0000037982 AGTGCAAGCAAGATGTTCTTA pLKO.1 747 CDS 100% 5.625 3.938 N PACSIN2 n/a
5 TRCN0000298925 AGTGCAAGCAAGATGTTCTTA pLKO_005 747 CDS 100% 5.625 3.938 N PACSIN2 n/a
6 TRCN0000037980 GAACGATGACTTCGAGAAGAT pLKO.1 475 CDS 100% 4.950 3.465 N PACSIN2 n/a
7 TRCN0000298854 GAACGATGACTTCGAGAAGAT pLKO_005 475 CDS 100% 4.950 3.465 N PACSIN2 n/a
8 TRCN0000310182 GTGCCTGTTGGCCTATCATAG pLKO_005 1751 3UTR 100% 10.800 6.480 N PACSIN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001349972.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02658 pDONR223 100% 91.1% 91.1% None 907_912delGATGAA;1034_1035ins123 n/a
2 ccsbBroad304_02658 pLX_304 0% 91.1% 91.1% V5 907_912delGATGAA;1034_1035ins123 n/a
3 TRCN0000480029 ACGCACCCCAACCCGAGGACACGG pLX_317 25.7% 91.1% 91.1% V5 907_912delGATGAA;1034_1035ins123 n/a
Download CSV