Transcript: Mouse NM_001159510.1

Mus musculus protein kinase C and casein kinase substrate in neurons 2 (Pacsin2), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Pacsin2 (23970)
Length:
3644
CDS:
173..1633

Additional Resources:

NCBI RefSeq record:
NM_001159510.1
NBCI Gene record:
Pacsin2 (23970)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001159510.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305725 GGTTGGTGCAAGGGACGTTTA pLKO_005 1559 CDS 100% 10.800 15.120 N Pacsin2 n/a
2 TRCN0000088733 CGGGTCATACTGATTCTTGTT pLKO.1 1974 3UTR 100% 4.950 3.960 N Pacsin2 n/a
3 TRCN0000324235 CGGGTCATACTGATTCTTGTT pLKO_005 1974 3UTR 100% 4.950 3.960 N Pacsin2 n/a
4 TRCN0000305666 TCCAATGTGGCTAGCTATAAA pLKO_005 944 CDS 100% 15.000 10.500 N Pacsin2 n/a
5 TRCN0000305724 TGGTCTGATGATGAGTCTAAC pLKO_005 1364 CDS 100% 10.800 7.560 N Pacsin2 n/a
6 TRCN0000088737 CTAAAGACCAAGGACAAGTAT pLKO.1 776 CDS 100% 5.625 3.938 N Pacsin2 n/a
7 TRCN0000088735 CTGACCAAGATAGAGGATGAA pLKO.1 1529 CDS 100% 4.950 3.465 N Pacsin2 n/a
8 TRCN0000088734 GCAGTTACAGTCCAGCTACAA pLKO.1 1237 CDS 100% 4.950 3.465 N Pacsin2 n/a
9 TRCN0000088736 TCACTGATGAATGAAGACTTT pLKO.1 479 CDS 100% 4.950 3.465 N Pacsin2 n/a
10 TRCN0000324234 TCACTGATGAATGAAGACTTT pLKO_005 479 CDS 100% 4.950 3.465 N Pacsin2 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2772 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159510.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02658 pDONR223 100% 89% 93.8% None (many diffs) n/a
2 ccsbBroad304_02658 pLX_304 0% 89% 93.8% V5 (many diffs) n/a
3 TRCN0000480029 ACGCACCCCAACCCGAGGACACGG pLX_317 25.7% 89% 93.8% V5 (many diffs) n/a
Download CSV