Construct: ORF TRCN0000480051
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002283.1_s317c1
- Derived from:
- ccsbBroadEn_02568
- DNA Barcode:
- GCCTTTAATCGGCGTATCCCCGCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KDELR1 (10945)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480051
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10945 | KDELR1 | KDEL endoplasmic reticulum ... | NM_006801.3 | 100% | 100% | |
| 2 | mouse | 68137 | Kdelr1 | KDEL (Lys-Asp-Glu-Leu) endo... | NM_133950.2 | 91.1% | 99.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 702
- ORF length:
- 636
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa tctcttccga ttcctgggag acctctccca cctcctcgcc atcatcttgc 121 tactgctcaa aatctggaag tcccgctcgt gcgccggaat ttcagggaag agccaggtcc 181 tgtttgctgt ggtgttcact gcccgatatc tggacctctt caccaactac atctcactct 241 acaacacgtg tatgaaggtg gtctacatag cctgctcctt caccacggtc tggttgattt 301 atagcaagtt caaagctact tacgatggga accatgacac gttcagagtg gagttcctgg 361 tcgttcccac agccattctg gcgttcctgg tcaatcatga cttcacccct ctggagatcc 421 tctggaCCTT CTCCATCTAC CTGGAGTCAG TGGCCATCTT GCCGCAGCTG TTCATGGTGA 481 GCAAGACCGG CGAGGCGGAG ACCATCACCA GCCACTACTT GTTTGCGCTA GGCGTTTACC 541 GCACGCTCTA TCTCTTCAAC TGGATCTGGC GCTACCATTT CGAGGGCTTC TTCGACCTCA 601 TCGCCATTGT GGCAGGCCTG GTCCAGACAG TCCTCTACTG CGATTTCTTC TACCTCTATA 661 TCACCAAAGT CCTAAAGGGG AAGAAGTTGA GTTTGCCGGC ATACCCAACT TTCTTGTACA 721 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 781 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 841 AGGACGAGCC TTTAATCGGC GTATCCCCGC AACGCGTTAA GTCgacaatc aacctctgga 901 ttacaaaatt tgtgaaagat t