Transcript: Human NM_006801.3

Homo sapiens KDEL endoplasmic reticulum protein retention receptor 1 (KDELR1), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
KDELR1 (10945)
Length:
1550
CDS:
194..832

Additional Resources:

NCBI RefSeq record:
NM_006801.3
NBCI Gene record:
KDELR1 (10945)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006801.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303717 TGGTGTTCACTGCCCGATATC pLKO_005 318 CDS 100% 10.800 15.120 N KDELR1 n/a
2 TRCN0000063250 CAACTACATCTCACTCTACAA pLKO.1 352 CDS 100% 4.950 6.930 N KDELR1 n/a
3 TRCN0000299600 CAACTACATCTCACTCTACAA pLKO_005 352 CDS 100% 4.950 6.930 N KDELR1 n/a
4 TRCN0000063249 GCTACTTACGATGGGAACCAT pLKO.1 443 CDS 100% 3.000 4.200 N KDELR1 n/a
5 TRCN0000303718 ACTGGTTGCCAAACACTAAAT pLKO_005 1223 3UTR 100% 13.200 9.240 N KDELR1 n/a
6 TRCN0000063248 GCGATTTCTTCTACCTCTATA pLKO.1 768 CDS 100% 13.200 9.240 N KDELR1 n/a
7 TRCN0000299598 GCGATTTCTTCTACCTCTATA pLKO_005 768 CDS 100% 13.200 9.240 N KDELR1 n/a
8 TRCN0000054458 CTGCGATTTCTTCTACCTCTA pLKO.1 766 CDS 100% 4.050 2.835 N Kdelr1 n/a
9 TRCN0000063251 GCTCTATCTCTTCAACTGGAT pLKO.1 673 CDS 100% 2.640 1.848 N KDELR1 n/a
10 TRCN0000299599 GCTCTATCTCTTCAACTGGAT pLKO_005 673 CDS 100% 2.640 1.848 N KDELR1 n/a
11 TRCN0000063252 AGCCACTACTTGTTTGCGCTA pLKO.1 638 CDS 100% 2.160 1.512 N KDELR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006801.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02568 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02568 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480051 GCCTTTAATCGGCGTATCCCCGCA pLX_317 43.5% 100% 100% V5 n/a
4 ccsbBroadEn_11573 pDONR223 100% 82.2% 67.9% None (many diffs) n/a
5 ccsbBroad304_11573 pLX_304 0% 82.2% 67.9% V5 (many diffs) n/a
6 TRCN0000469776 AAGCTAAAGAAGCTGGACCGACCC pLX_317 83.2% 82.2% 67.9% V5 (many diffs) n/a
Download CSV