Transcript: Mouse NM_133950.2

Mus musculus KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 (Kdelr1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Kdelr1 (68137)
Length:
1525
CDS:
172..810

Additional Resources:

NCBI RefSeq record:
NM_133950.2
NBCI Gene record:
Kdelr1 (68137)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133950.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303717 TGGTGTTCACTGCCCGATATC pLKO_005 296 CDS 100% 10.800 15.120 N KDELR1 n/a
2 TRCN0000054460 CAACTACATTTCACTCTACAA pLKO.1 330 CDS 100% 4.950 6.930 N Kdelr1 n/a
3 TRCN0000054458 CTGCGATTTCTTCTACCTCTA pLKO.1 744 CDS 100% 4.050 5.670 N Kdelr1 n/a
4 TRCN0000063248 GCGATTTCTTCTACCTCTATA pLKO.1 746 CDS 100% 13.200 9.240 N KDELR1 n/a
5 TRCN0000299598 GCGATTTCTTCTACCTCTATA pLKO_005 746 CDS 100% 13.200 9.240 N KDELR1 n/a
6 TRCN0000054462 GTACACTCTATCTCTTCAATT pLKO.1 647 CDS 100% 13.200 9.240 N Kdelr1 n/a
7 TRCN0000054459 CCTCCTAGCTATCATCTTGTT pLKO.1 207 CDS 100% 4.950 3.465 N Kdelr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133950.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02568 pDONR223 100% 91.1% 99.5% None (many diffs) n/a
2 ccsbBroad304_02568 pLX_304 0% 91.1% 99.5% V5 (many diffs) n/a
3 TRCN0000480051 GCCTTTAATCGGCGTATCCCCGCA pLX_317 43.5% 91.1% 99.5% V5 (many diffs) n/a
4 ccsbBroadEn_11573 pDONR223 100% 74% 67.5% None (many diffs) n/a
5 ccsbBroad304_11573 pLX_304 0% 74% 67.5% V5 (many diffs) n/a
6 TRCN0000469776 AAGCTAAAGAAGCTGGACCGACCC pLX_317 83.2% 74% 67.5% V5 (many diffs) n/a
Download CSV