Construct: ORF TRCN0000480130
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009258.1_s317c1
- Derived from:
- ccsbBroadEn_08378
- DNA Barcode:
- GAGCTGAACTCGCGAGCAGCCTTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RETREG1 (54463)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480130
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 54463 | RETREG1 | reticulophagy regulator 1 | NM_019000.4 | 99.9% | 100% | 393C>T |
| 2 | human | 54463 | RETREG1 | reticulophagy regulator 1 | XM_011514055.3 | 95.9% | 95% | (many diffs) |
| 3 | human | 54463 | RETREG1 | reticulophagy regulator 1 | XM_024446117.1 | 90.3% | 90.4% | 0_1ins102;291C>T |
| 4 | human | 54463 | RETREG1 | reticulophagy regulator 1 | XM_024446118.1 | 90.3% | 90.4% | 0_1ins102;291C>T |
| 5 | human | 54463 | RETREG1 | reticulophagy regulator 1 | XM_011514054.2 | 89.8% | 89.6% | 36_155del;513C>T |
| 6 | human | 54463 | RETREG1 | reticulophagy regulator 1 | NM_001034850.2 | 70.9% | 68.5% | (many diffs) |
| 7 | human | 54463 | RETREG1 | reticulophagy regulator 1 | XM_011514053.3 | 65.7% | 64.6% | (many diffs) |
| 8 | mouse | 66270 | Retreg1 | reticulophagy regulator 1 | NM_001277315.1 | 89% | 91.5% | (many diffs) |
| 9 | mouse | 66270 | Retreg1 | reticulophagy regulator 1 | NM_025459.3 | 89% | 91.5% | (many diffs) |
| 10 | mouse | 66270 | Retreg1 | reticulophagy regulator 1 | XM_006520134.3 | 89% | 91.5% | (many diffs) |
| 11 | mouse | 66270 | Retreg1 | reticulophagy regulator 1 | XM_017316720.1 | 89% | 91.5% | (many diffs) |
| 12 | mouse | 66270 | Retreg1 | reticulophagy regulator 1 | NM_001277317.1 | 86.7% | 89.8% | (many diffs) |
| 13 | mouse | 66270 | Retreg1 | reticulophagy regulator 1 | NM_001277316.1 | 85.4% | 88.1% | (many diffs) |
| 14 | mouse | 66270 | Retreg1 | reticulophagy regulator 1 | NM_001277318.1 | 80.8% | 83.9% | (many diffs) |
| 15 | mouse | 66270 | Retreg1 | reticulophagy regulator 1 | NM_001034851.2 | 65.7% | 65.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1134
- ORF length:
- 1068
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc tgaaggtgaa gactttggac caggcaaaag ctgggaagtt atcaattcca 121 aaccagatga aagacccagg ctcagccact gtattgcaga atcatggatg aatttcagca 181 tatttcttca agaaatgtct ctttttaaac agcagagccc tggcaagttt tgtctcctgg 241 tctgtagtgt gtgcacattt tttacgatct tgggaagtta cattcctggg gttatactca 301 gctatctact gttactgtgt gcatttttgt gtccattgtt taaatgtaat gatattggac 361 aaaaaattta cagcaaaatt aagtcagttc tgctgaaact ggattttgga attggagaat 421 atattaatca gaagaaacgt gagagatctg aagcagataa agaaaaaagt cacaaagatg 481 acagtgaatt agacttttca gctctttgtc ctaagattag cctcacggtt gctgccaaag 541 agttatctgt gtctgacaca gacgtctcag aggtatcctg gactgataat gggaccttca 601 acctttcaga aggatacact ccacagacag acacttctga tgatcttgac cgacccagtg 661 aggaagtttt ctctagagat ctttcagatt ttccatctct agaaaatggc atgggaacaa 721 atgatgaaga tgaattaagc cttggtttgc ccactgagct caagagaaag aaggaacagt 781 tggacagtgg tcacagacca agcaaagaga cgcaatcagc agctggtctc acccttcctc 841 tgaacagtga ccaaaCCTTT CACCTGATGA GCAACCTGGC TGGGGATGTT ATCACAGCTG 901 CAGTGACTGC AGCTATCAAA GACCAGTTAG AGGGTGTGCA GCAAGCACTT TCTCAGGCTG 961 CCCCCATCCC AGAAGAGGAC ACAGACACTG AAGAAGGTGA TGACTTTGAA CTACTTGACC 1021 AGTCAGAGCT GGATCAAATT GAGAGTGAAT TGGGACTTAC ACAAGACCAG GAAGCAGAAG 1081 CACAGCAAAA TAAGAAGTCT TCAGGTTTCC TTTCAAATCT GCTGGGAGGC CATTACCCAA 1141 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 1201 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1261 TATCTTGTGG AAAGGACGAG AGCTGAACTC GCGAGCAGCC TTGACGCGTT AAGTCgacaa 1321 tcaacctctg gattacaaaa tttgtgaaag att