Transcript: Mouse NM_025459.3

Mus musculus reticulophagy regulator 1 (Retreg1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-31
Taxon:
Mus musculus (mouse)
Gene:
Retreg1 (66270)
Length:
2929
CDS:
209..1279

Additional Resources:

NCBI RefSeq record:
NM_025459.3
NBCI Gene record:
Retreg1 (66270)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025459.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217409 GAAGCTGGGAAGTCATCAATT pLKO.1 240 CDS 100% 13.200 18.480 N Retreg1 n/a
2 TRCN0000173313 GATGAATTAAGCCTGGGCTTA pLKO.1 872 CDS 100% 0.405 0.324 N Retreg1 n/a
3 TRCN0000329534 AGTCAAGTCCATTCTATTAAA pLKO_005 520 CDS 100% 15.000 10.500 N Retreg1 n/a
4 TRCN0000176408 CACAAGGATGACAGTGAATTA pLKO.1 614 CDS 100% 13.200 9.240 N Retreg1 n/a
5 TRCN0000329531 CACAAGGATGACAGTGAATTA pLKO_005 614 CDS 100% 13.200 9.240 N Retreg1 n/a
6 TRCN0000215856 CAGCATGTTTCTTCAAGAAAT pLKO.1 319 CDS 100% 13.200 9.240 N Retreg1 n/a
7 TRCN0000193706 CAGCTCTTTGTCCTAAGATTA pLKO.1 642 CDS 100% 13.200 9.240 N Retreg1 n/a
8 TRCN0000427884 TAAGCATGGAAATGAACTTTA pLKO_005 1493 3UTR 100% 13.200 9.240 N RETREG1 n/a
9 TRCN0000426652 TGCAGAATCATGGATGAATTT pLKO_005 298 CDS 100% 13.200 9.240 N RETREG1 n/a
10 TRCN0000353559 CAATCTTGGGAAGTTACATTC pLKO_005 408 CDS 100% 10.800 7.560 N Retreg1 n/a
11 TRCN0000173724 CAGCTACCTTCTGTTACTGTT pLKO.1 442 CDS 100% 4.950 3.465 N Retreg1 n/a
12 TRCN0000329461 CAGCTACCTTCTGTTACTGTT pLKO_005 442 CDS 100% 4.950 3.465 N Retreg1 n/a
13 TRCN0000216687 CAGGCAGAGCTAGATCAAATT pLKO.1 1163 CDS 100% 13.200 7.920 N Retreg1 n/a
14 TRCN0000176380 CATTGCAGAATCATGGATGAA pLKO.1 295 CDS 100% 4.950 2.970 N Retreg1 n/a
15 TRCN0000194421 CCTAAGATTAGCCTCACAGTT pLKO.1 653 CDS 100% 4.950 2.970 N Retreg1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025459.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08378 pDONR223 100% 89% 91.5% None (many diffs) n/a
2 ccsbBroad304_08378 pLX_304 0% 89% 91.5% V5 (many diffs) n/a
3 TRCN0000480130 GAGCTGAACTCGCGAGCAGCCTTG pLX_317 26.5% 89% 91.5% V5 (many diffs) n/a
4 ccsbBroadEn_12043 pDONR223 100% 33.5% 34.2% None (many diffs) n/a
5 ccsbBroad304_12043 pLX_304 0% 33.5% 34.2% V5 (many diffs) n/a
6 TRCN0000471638 CCCTCTGCGTCATTAGCAGCGTTA pLX_317 100% 33.5% 34.2% V5 (many diffs) n/a
Download CSV