Transcript: Human NM_019000.4

Homo sapiens reticulophagy regulator 1 (RETREG1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
RETREG1 (54463)
Length:
3184
CDS:
387..1457

Additional Resources:

NCBI RefSeq record:
NM_019000.4
NBCI Gene record:
RETREG1 (54463)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_019000.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062212 CTACTGTTACTGTGTGCATTT pLKO.1 627 CDS 100% 10.800 15.120 N RETREG1 n/a
2 TRCN0000421826 ACCAAGCAAAGAGACGCAATC pLKO_005 1118 CDS 100% 6.000 8.400 N RETREG1 n/a
3 TRCN0000062210 CCTAAGATTAGCCTCACGGTT pLKO.1 831 CDS 100% 2.640 3.696 N RETREG1 n/a
4 TRCN0000193706 CAGCTCTTTGTCCTAAGATTA pLKO.1 820 CDS 100% 13.200 9.240 N Retreg1 n/a
5 TRCN0000424969 GAGGTATCCTGGACTGATAAT pLKO_005 891 CDS 100% 13.200 9.240 N RETREG1 n/a
6 TRCN0000427884 TAAGCATGGAAATGAACTTTA pLKO_005 1665 3UTR 100% 13.200 9.240 N RETREG1 n/a
7 TRCN0000426652 TGCAGAATCATGGATGAATTT pLKO_005 476 CDS 100% 13.200 9.240 N RETREG1 n/a
8 TRCN0000424410 CGATCTTGGGAAGTTACATTC pLKO_005 586 CDS 100% 10.800 7.560 N RETREG1 n/a
9 TRCN0000062208 GCAGCTATCAAAGACCAGTTA pLKO.1 1230 CDS 100% 4.950 3.465 N RETREG1 n/a
10 TRCN0000062211 GTCTTCAGGTTTCCTTTCAAA pLKO.1 1418 CDS 100% 5.625 3.375 N RETREG1 n/a
11 TRCN0000062209 CCACAGACAGACACTTCTGAT pLKO.1 942 CDS 100% 4.950 2.970 N RETREG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019000.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08378 pDONR223 100% 99.9% 100% None 393C>T n/a
2 ccsbBroad304_08378 pLX_304 0% 99.9% 100% V5 393C>T n/a
3 TRCN0000480130 GAGCTGAACTCGCGAGCAGCCTTG pLX_317 26.5% 99.9% 100% V5 393C>T n/a
4 ccsbBroadEn_12043 pDONR223 100% 39.6% 39.6% None 1_645del n/a
5 ccsbBroad304_12043 pLX_304 0% 39.6% 39.6% V5 1_645del n/a
6 TRCN0000471638 CCCTCTGCGTCATTAGCAGCGTTA pLX_317 100% 39.6% 39.6% V5 1_645del n/a
Download CSV