Transcript: Human NM_001034850.2

Homo sapiens reticulophagy regulator 1 (RETREG1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
RETREG1 (54463)
Length:
3308
CDS:
88..1581

Additional Resources:

NCBI RefSeq record:
NM_001034850.2
NBCI Gene record:
RETREG1 (54463)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001034850.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062212 CTACTGTTACTGTGTGCATTT pLKO.1 751 CDS 100% 10.800 15.120 N RETREG1 n/a
2 TRCN0000421826 ACCAAGCAAAGAGACGCAATC pLKO_005 1242 CDS 100% 6.000 8.400 N RETREG1 n/a
3 TRCN0000062210 CCTAAGATTAGCCTCACGGTT pLKO.1 955 CDS 100% 2.640 3.696 N RETREG1 n/a
4 TRCN0000193706 CAGCTCTTTGTCCTAAGATTA pLKO.1 944 CDS 100% 13.200 9.240 N Retreg1 n/a
5 TRCN0000424969 GAGGTATCCTGGACTGATAAT pLKO_005 1015 CDS 100% 13.200 9.240 N RETREG1 n/a
6 TRCN0000427884 TAAGCATGGAAATGAACTTTA pLKO_005 1789 3UTR 100% 13.200 9.240 N RETREG1 n/a
7 TRCN0000426652 TGCAGAATCATGGATGAATTT pLKO_005 600 CDS 100% 13.200 9.240 N RETREG1 n/a
8 TRCN0000424410 CGATCTTGGGAAGTTACATTC pLKO_005 710 CDS 100% 10.800 7.560 N RETREG1 n/a
9 TRCN0000062208 GCAGCTATCAAAGACCAGTTA pLKO.1 1354 CDS 100% 4.950 3.465 N RETREG1 n/a
10 TRCN0000062211 GTCTTCAGGTTTCCTTTCAAA pLKO.1 1542 CDS 100% 5.625 3.375 N RETREG1 n/a
11 TRCN0000062209 CCACAGACAGACACTTCTGAT pLKO.1 1066 CDS 100% 4.950 2.970 N RETREG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001034850.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08378 pDONR223 100% 70.9% 68.5% None (many diffs) n/a
2 ccsbBroad304_08378 pLX_304 0% 70.9% 68.5% V5 (many diffs) n/a
3 TRCN0000480130 GAGCTGAACTCGCGAGCAGCCTTG pLX_317 26.5% 70.9% 68.5% V5 (many diffs) n/a
4 ccsbBroadEn_12043 pDONR223 100% 28.3% 28.3% None 1_1068del n/a
5 ccsbBroad304_12043 pLX_304 0% 28.3% 28.3% V5 1_1068del n/a
6 TRCN0000471638 CCCTCTGCGTCATTAGCAGCGTTA pLX_317 100% 28.3% 28.3% V5 1_1068del n/a
Download CSV