Construct: ORF TRCN0000480200
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000656.2_s317c1
- Derived from:
- ccsbBroadEn_02215
- DNA Barcode:
- GGAGGTATAATTCGTGGGTGGTGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TESMIN (9633)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480200
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 9633 | TESMIN | testis expressed metallothi... | NM_001039656.1 | 100% | 100% | |
2 | human | 9633 | TESMIN | testis expressed metallothi... | NM_004923.3 | 60.2% | 60.2% | 919_1524del |
3 | human | 9633 | TESMIN | testis expressed metallothi... | XM_011545402.1 | 58.9% | 58.9% | 919_1557del |
4 | human | 9633 | TESMIN | testis expressed metallothi... | XM_011545403.2 | 58.9% | 58.9% | 919_1557del |
5 | human | 9633 | TESMIN | testis expressed metallothi... | XR_950115.1 | 54.2% | 1_184del;813_814ins121;982_1349del | |
6 | human | 9633 | TESMIN | testis expressed metallothi... | XM_017018588.1 | 46.2% | 46.2% | 630_631ins198;721_1359del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 987
- ORF length:
- 918
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggaggagggc cctctgccgg gcgggctgcc cagccccgag gatgcgatgg 121 tgacggagct cttaagcccc gagggtccgt tcgcttcgga gaacatcggc ctgaaggccc 181 ccgtgaagta cgaggaggac gagttccacg tcttcaaaga agcgtacctg ggcccggcgg 241 accccaagga acccgtcctg cacgcgttca accccgcgct gggcgccgac tgcaagggcc 301 aggtcaaggc gaagctcgcg gggggcgaca gcgacggcgg ggagctcctc ggggagtacc 361 ccgggatccc agagctcagc gcgctggagg acgtcgcgct cctgcaggcc ccgcagccgc 421 ccgcctgcaa cgtgcacttc ctgtcctcgc tgctacccgc gcaccgcagc ccggcggtgt 481 tgcccctggg cgcctgggtc ctggaaggag cctcccaccc gggcgtccgc atgatcccag 541 ttgaaatcaa ggaagcaggt ggtactacta caagtaataa tccggaagaa gcaactttgc 601 agaatcttct tgcTCAGGAA TCCTGTTGCA AGTTCCCATC GTCCCAGGAA CTAGAGGATG 661 CCTCCTGCTG TTCTCTTAAG AAAGATTCCA ACCCAATGGT GATATGCCAA TTGAAAGGGG 721 GCACACAAAT GCTATGTATA GACAATTCTA GAACAAGAGA ACTAAAAGCA CTCCATTTGG 781 TTCCTCAGTA TCAAGATCAA AATAATTATC TACAGTCAGA TGTCCCTAAA CCAATGACTG 841 CTTTAGTAGG GAGATTTTTG CCAGCATCAA CAAAATTAAA TCTCATTACA CAACAACTTG 901 AGGGAGCCTT ACCATCGGTA GTCAACGGGT CTGCTTTCCC CTCGGGATCA ACTCTTCCAG 961 GACCACCAAA AATAACTTTG GCTGGGTTGC CAACTTTCTT GTACAAAGTG GTTGATATCG 1021 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1081 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAGGAGGTAT 1141 AATTCGTGGG TGGTGTACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1201 aagatt