Transcript: Human NM_004923.3

Homo sapiens testis expressed metallothionein like protein (TESMIN), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
TESMIN (9633)
Length:
2535
CDS:
141..1667

Additional Resources:

NCBI RefSeq record:
NM_004923.3
NBCI Gene record:
TESMIN (9633)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004923.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000376546 GAGTGCTATGAGGCCCAAATT pLKO_005 1287 CDS 100% 13.200 18.480 N TESMIN n/a
2 TRCN0000376545 GCATGGCCTGAGCATTGTTTG pLKO_005 1854 3UTR 100% 10.800 8.640 N TESMIN n/a
3 TRCN0000370033 TTCTCCACACTGAGTTTAAAT pLKO_005 1624 CDS 100% 15.000 10.500 N TESMIN n/a
4 TRCN0000370077 ACAACTTGCATCATGATATTG pLKO_005 1120 CDS 100% 13.200 9.240 N TESMIN n/a
5 TRCN0000365085 ATTCCAACCCAATGGTGATAT pLKO_005 757 CDS 100% 13.200 9.240 N TESMIN n/a
6 TRCN0000107890 GCTGTTGTGATACCACTTAAA pLKO.1 2140 3UTR 100% 13.200 9.240 N TESMIN n/a
7 TRCN0000365086 GGTGGTACTACTACAAGTAAT pLKO_005 630 CDS 100% 13.200 9.240 N TESMIN n/a
8 TRCN0000107894 CCCAAATTATGTGTTCTTCTA pLKO.1 1300 CDS 100% 4.950 3.465 N TESMIN n/a
9 TRCN0000107892 GCAACTTTGCAGAATCTTCTT pLKO.1 663 CDS 100% 4.950 3.465 N TESMIN n/a
10 TRCN0000107891 GCCCAGAACGAAAGACACTAA pLKO.1 1357 CDS 100% 4.950 3.465 N TESMIN n/a
11 TRCN0000107893 CCACGTCTTCAAAGAAGCGTA pLKO.1 278 CDS 100% 2.640 1.848 N TESMIN n/a
12 TRCN0000376544 TACCTGCCACCAACGAAATTT pLKO_005 1425 CDS 100% 0.000 0.000 N TESMIN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004923.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02215 pDONR223 100% 60.2% 60.2% None 919_1524del n/a
2 ccsbBroad304_02215 pLX_304 0% 60.2% 60.2% V5 919_1524del n/a
3 TRCN0000480200 GGAGGTATAATTCGTGGGTGGTGT pLX_317 40.8% 60.2% 60.2% V5 919_1524del n/a
Download CSV