Transcript: Human XM_011545403.2

PREDICTED: Homo sapiens testis expressed metallothionein like protein (TESMIN), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TESMIN (9633)
Length:
2185
CDS:
54..1613

Additional Resources:

NCBI RefSeq record:
XM_011545403.2
NBCI Gene record:
TESMIN (9633)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545403.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000376546 GAGTGCTATGAGGCCCAAATT pLKO_005 1200 CDS 100% 13.200 18.480 N TESMIN n/a
2 TRCN0000370077 ACAACTTGCATCATGATATTG pLKO_005 1033 CDS 100% 13.200 9.240 N TESMIN n/a
3 TRCN0000365085 ATTCCAACCCAATGGTGATAT pLKO_005 670 CDS 100% 13.200 9.240 N TESMIN n/a
4 TRCN0000365086 GGTGGTACTACTACAAGTAAT pLKO_005 543 CDS 100% 13.200 9.240 N TESMIN n/a
5 TRCN0000107894 CCCAAATTATGTGTTCTTCTA pLKO.1 1213 CDS 100% 4.950 3.465 N TESMIN n/a
6 TRCN0000107892 GCAACTTTGCAGAATCTTCTT pLKO.1 576 CDS 100% 4.950 3.465 N TESMIN n/a
7 TRCN0000107891 GCCCAGAACGAAAGACACTAA pLKO.1 1270 CDS 100% 4.950 3.465 N TESMIN n/a
8 TRCN0000107893 CCACGTCTTCAAAGAAGCGTA pLKO.1 191 CDS 100% 2.640 1.848 N TESMIN n/a
9 TRCN0000376544 TACCTGCCACCAACGAAATTT pLKO_005 1338 CDS 100% 0.000 0.000 N TESMIN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545403.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02215 pDONR223 100% 58.9% 58.9% None 919_1557del n/a
2 ccsbBroad304_02215 pLX_304 0% 58.9% 58.9% V5 919_1557del n/a
3 TRCN0000480200 GGAGGTATAATTCGTGGGTGGTGT pLX_317 40.8% 58.9% 58.9% V5 919_1557del n/a
Download CSV