Transcript: Mouse XM_017313887.1

PREDICTED: Mus musculus cell division cycle 34 (Cdc34), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cdc34 (216150)
Length:
1094
CDS:
48..755

Additional Resources:

NCBI RefSeq record:
XM_017313887.1
NBCI Gene record:
Cdc34 (216150)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313887.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436126 ACGCCTCGGTGATGTACAGAA pLKO_005 475 CDS 100% 4.950 6.930 N Cdc34 n/a
2 TRCN0000422566 GGACGTGTGCATCTCCATTCT pLKO_005 317 CDS 100% 4.950 6.930 N Cdc34 n/a
3 TRCN0000098520 CCATGATCCTTAGGTCCTCTT pLKO.1 856 3UTR 100% 4.050 5.670 N Cdc34 n/a
4 TRCN0000098521 GAGTGTAATTTCGCTGCTGAA pLKO.1 422 CDS 100% 4.050 5.670 N Cdc34 n/a
5 TRCN0000098523 CCACACAGAATGTCAGAACCA pLKO.1 394 CDS 100% 2.640 3.696 N Cdc34 n/a
6 TRCN0000437507 TGACCCACGTCCCTGAAATAA pLKO_005 753 CDS 100% 15.000 10.500 N Cdc34 n/a
7 TRCN0000098524 CTCTTCTACGACGACTACTAT pLKO.1 660 CDS 100% 5.625 3.938 N Cdc34 n/a
8 TRCN0000437524 CCACTCAGCTTTCAGATGATG pLKO_005 940 3UTR 100% 4.950 3.465 N Cdc34 n/a
9 TRCN0000419064 ATGGTGTGAAGGTGCCCACTA pLKO_005 583 CDS 100% 4.050 2.835 N Cdc34 n/a
10 TRCN0000434287 GAGTACTGCGTGAAGACCAAG pLKO_005 612 CDS 100% 4.050 2.835 N Cdc34 n/a
11 TRCN0000434317 GGGATGAAGAGGATGACTCTG pLKO_005 718 CDS 100% 4.050 2.430 N Cdc34 n/a
12 TRCN0000098522 CCGCGAGTACACGGACATCAT pLKO.1 521 CDS 100% 1.650 0.990 N Cdc34 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313887.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00274 pDONR223 100% 90.8% 99.1% None (many diffs) n/a
2 ccsbBroad304_00274 pLX_304 0% 90.8% 99.1% V5 (many diffs) n/a
3 TRCN0000480218 TCGAACTCATATTTCAATCACCTA pLX_317 54.8% 90.8% 99.1% V5 (many diffs) n/a
Download CSV