Construct: ORF TRCN0000480405
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010551.1_s317c1
- Derived from:
- ccsbBroadEn_03600
- DNA Barcode:
- TACGAAGCCAATGTCGCATGCTTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SMPD3 (55512)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480405
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 55512 | SMPD3 | sphingomyelin phosphodieste... | NM_018667.4 | 100% | 100% | |
2 | human | 55512 | SMPD3 | sphingomyelin phosphodieste... | XM_005256031.4 | 100% | 100% | |
3 | human | 55512 | SMPD3 | sphingomyelin phosphodieste... | XM_005256032.3 | 100% | 100% | |
4 | human | 55512 | SMPD3 | sphingomyelin phosphodieste... | XM_011523207.1 | 100% | 100% | |
5 | human | 55512 | SMPD3 | sphingomyelin phosphodieste... | XM_011523208.2 | 100% | 100% | |
6 | human | 55512 | SMPD3 | sphingomyelin phosphodieste... | XM_011523209.2 | 100% | 100% | |
7 | human | 55512 | SMPD3 | sphingomyelin phosphodieste... | XM_017023405.1 | 100% | 100% | |
8 | human | 55512 | SMPD3 | sphingomyelin phosphodieste... | XM_017023406.1 | 100% | 100% | |
9 | human | 55512 | SMPD3 | sphingomyelin phosphodieste... | XM_017023407.1 | 100% | 100% | |
10 | human | 55512 | SMPD3 | sphingomyelin phosphodieste... | XM_017023408.1 | 100% | 100% | |
11 | human | 55512 | SMPD3 | sphingomyelin phosphodieste... | XM_011523210.2 | 70.7% | 67.6% | (many diffs) |
12 | human | 55512 | SMPD3 | sphingomyelin phosphodieste... | XR_933371.2 | 66.3% | (many diffs) | |
13 | mouse | 58994 | Smpd3 | sphingomyelin phosphodieste... | NM_021491.3 | 86.5% | 91% | (many diffs) |
14 | mouse | 58994 | Smpd3 | sphingomyelin phosphodieste... | XM_006531241.3 | 86.5% | 91% | (many diffs) |
15 | mouse | 58994 | Smpd3 | sphingomyelin phosphodieste... | XM_011248462.1 | 86.5% | 91% | (many diffs) |
16 | mouse | 58994 | Smpd3 | sphingomyelin phosphodieste... | XM_011248463.2 | 86.5% | 91% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 2034
- ORF length:
- 1965
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggttttgtac acgaccccct ttcctaacag ctgtctgtcc gccctgcact 121 gtgtgtcctg ggcccttatc tttccatgct actggctggt ggaccggctc gctgcctcct 181 tcatacccac cacctacgag aagcgccagc gggcagacga cccgtgctgc ctgcagctgc 241 tctgcactgc cctcttcacg cccatctacc tggccctcct ggtggcctcg ctgccctttg 301 cgtttctcgg ctttctcttc tggtccccac tgcagtcggc ccgccggccc tacatctatt 361 cacggctgga agacaagggc ctggccggtg gggcagccct gctcagtgaa tggaagggca 421 cggggcctgg caaaagcttc tgctttgcca ctgccaacgt ctgcctcctg cccgactcac 481 tcgccagggt caacaacctt tttaacaccc aagcgcgggc caaggagatc gggcagagaa 541 tccgcaatgg ggccgcccgg ccccagatca aaatttacat cgactccccc accaatacct 601 ccatcagcgc cgctagcttc agcagcctgg tgtcaccaca gggcggcgat ggggtggccc 661 gggccgtccc cgggagcatt aagaggacag cctctgtgga gtacaagggt gacggtgggc 721 ggcaccccgg tgacgaggct gccaacggcc cagcctctgg ggaccctgtc gacagcagca 781 gcccggagga tgcctgcatc gtgcgcatcg gtggcgagga gggcggccgg ccacctgaag 841 ctgacgaccc tgtgcctggg ggccaggcca ggaacggagc tggcgggggc ccaaggggcc 901 agacgcccaa ccataatcag caggacgggg attcagggag cctgggcagc ccctcggcct 961 cccgggagtc cctggtgaag gggcgagctg ggccagacac cagtgccagc ggggagccag 1021 gtgccaacag caagctcctg tacaaggcct cggtggtgaa gaaggcggct gcacgcagga 1081 ggcggcaccc cgacgaggcc ttcgaccatg aggtctccgc cttcttcccc gccaacctgg 1141 acttcctgtg cctgcaggag gtgtttgaca agcgagcagc caccaaattg aaagagcagc 1201 tgcacggcta cttcgagtac atcctgtacg acgtcggggt ctacggctgc cagggctgct 1261 gcagcttcaa gtgtctcaac agcggcctcc tctttgccag ccgctacccc atcatggacg 1321 tggcctatca ctgttacccc aacaagtgta acgacgatgc cctggcctct aagggagctc 1381 tgtttctcaa ggtgcaggtg ggaagcacac ctcaggacca aagaatcgtc gggtacatcg 1441 cctgcacaca cctgcatgcc ccgcaagagg acagcgccat ccggtgtggg cagctggacc 1501 tgcttcagga ctggctggct gatttccgaa aatctacctc ctcgtccagc gcagccaacc 1561 ccgaggagct ggtggcattt gacgtcgtct gtggagattt caactttgat aactgctcct 1621 ctgacgacaa gctggagcag caacactccc tgttcaccca ctacagggac ccctgccgcc 1681 tggggCCTGG TGAGGAGAAG CCGTGGGCCA TCGGTACTCT GCTGGACACG AACGGCCTGT 1741 ACGATGAGGA TGTGTGCACC CCCGACAACC TGCAGAAGGT CCTGGAGAGT GAGGAGGGCC 1801 GCAGGGAGTA CCTGGCGTTT CCCACCAGCA AGAGCTCGGG CCAGAAGGGG CGGAAGGAGC 1861 TGCTGAAGGG CAACGGCCGG CGCATCGACT ACATGCTGCA TGCAGAGGAG GGGCTGTGCC 1921 CAGACTGGAA GGCCGAGGTG GAAGAATTCA GTTTTATCAC CCAGCTGTCC GGCCTGACGG 1981 ACCACCTGCC AGTAGCCATG CGACTGATGG TGTCTTCGGG GGAGGAGGAG GCATTGCCAA 2041 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 2101 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 2161 TATCTTGTGG AAAGGACGAT ACGAAGCCAA TGTCGCATGC TTCACGCGTT AAGTCgacaa 2221 tcaacctctg gattacaaaa tttgtgaaag att