Transcript: Mouse XM_011248462.1

PREDICTED: Mus musculus sphingomyelin phosphodiesterase 3, neutral (Smpd3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Smpd3 (58994)
Length:
5011
CDS:
333..2300

Additional Resources:

NCBI RefSeq record:
XM_011248462.1
NBCI Gene record:
Smpd3 (58994)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248462.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419189 CTCACTCGCGAGGCTCAATAA pLKO_005 740 CDS 100% 13.200 18.480 N Smpd3 n/a
2 TRCN0000099416 CCAAAGAATTGTTGGGTACAT pLKO.1 1676 CDS 100% 4.950 6.930 N Smpd3 n/a
3 TRCN0000446463 CGCTCTTTACTCGCTACAAAG pLKO_005 1906 CDS 100% 10.800 8.640 N Smpd3 n/a
4 TRCN0000099415 CCATTCTTTCAGTCACGATTT pLKO.1 2542 3UTR 100% 10.800 7.560 N Smpd3 n/a
5 TRCN0000099419 CTGGACACAAACGGTCTCTAT pLKO.1 1980 CDS 100% 4.950 3.465 N Smpd3 n/a
6 TRCN0000099418 GCCTCAGATCAAGATCTACAT pLKO.1 824 CDS 100% 4.950 3.465 N Smpd3 n/a
7 TRCN0000099417 GCTAACAGCAAGCTGCTGTAT pLKO.1 1281 CDS 100% 0.495 0.347 N Smpd3 n/a
8 TRCN0000048947 CGCATCGACTACATGCTGCAT pLKO.1 2145 CDS 100% 2.640 1.848 N SMPD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248462.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03600 pDONR223 100% 86.5% 91% None (many diffs) n/a
2 ccsbBroad304_03600 pLX_304 0% 86.5% 91% V5 (many diffs) n/a
3 TRCN0000480405 TACGAAGCCAATGTCGCATGCTTC pLX_317 18% 86.5% 91% V5 (many diffs) n/a
Download CSV