Transcript: Human NM_018667.4

Homo sapiens sphingomyelin phosphodiesterase 3 (SMPD3), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
SMPD3 (55512)
Length:
5271
CDS:
425..2392

Additional Resources:

NCBI RefSeq record:
NM_018667.4
NBCI Gene record:
SMPD3 (55512)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018667.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048945 CCAAAGAATCGTCGGGTACAT pLKO.1 1774 CDS 100% 4.950 6.930 N SMPD3 n/a
2 TRCN0000430529 GCTTCGTCCAGGGTTCTTTAT pLKO_005 2726 3UTR 100% 13.200 9.240 N SMPD3 n/a
3 TRCN0000433908 CATTCTTTCACAACACGATTT pLKO_005 2620 3UTR 100% 10.800 7.560 N SMPD3 n/a
4 TRCN0000419303 TGTCCTGGGCCCTTATCTTTC pLKO_005 480 CDS 100% 10.800 7.560 N SMPD3 n/a
5 TRCN0000048944 GTGGAGATTTCAACTTTGATA pLKO.1 1947 CDS 100% 5.625 3.938 N SMPD3 n/a
6 TRCN0000048946 CCCTTTGCGTTTCTCGGCTTT pLKO.1 650 CDS 100% 4.050 2.835 N SMPD3 n/a
7 TRCN0000048943 CCCAACAAGTGTAACGACGAT pLKO.1 1694 CDS 100% 2.640 1.848 N SMPD3 n/a
8 TRCN0000048947 CGCATCGACTACATGCTGCAT pLKO.1 2237 CDS 100% 2.640 1.848 N SMPD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018667.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03600 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03600 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480405 TACGAAGCCAATGTCGCATGCTTC pLX_317 18% 100% 100% V5 n/a
Download CSV