Construct: ORF TRCN0000480427
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002296.1_s317c1
- Derived from:
- ccsbBroadEn_03814
- DNA Barcode:
- CTCTCTTATCCGTTTTAAAGTGAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RHOJ (57381)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480427
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 57381 | RHOJ | ras homolog family member J | NM_020663.5 | 100% | 100% | |
| 2 | human | 57381 | RHOJ | ras homolog family member J | XM_006720214.4 | 80.9% | 78.5% | (many diffs) |
| 3 | human | 57381 | RHOJ | ras homolog family member J | XM_011536993.3 | 74.2% | 74.2% | 234_235ins165 |
| 4 | human | 57381 | RHOJ | ras homolog family member J | XR_245709.4 | 18.7% | 1_458del;957_1076del;1221_3418del | |
| 5 | human | 57381 | RHOJ | ras homolog family member J | XR_245708.4 | 18.7% | 1_458del;956_1085del;1231_3428del | |
| 6 | mouse | 80837 | Rhoj | ras homolog family member J | NM_023275.2 | 87.8% | 92.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 708
- ORF length:
- 642
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa ctgcaaagag ggaactgaca gcagctgcgg ctgcaggggc aacgacgaga 121 agaagatgtt gaagtgtgtg gtggtggggg acggtgccgt ggggaaaacc tgcctgctga 181 tgagctacgc caacgacgcc ttcccagagg aatacgtgcc cactgtgttt gaccactatg 241 cagttactgt gactgtggga ggcaagcaac acttgctcgg actgtatgac accgcgggac 301 aggaggacta caaccagctg aggccactct cctaccccaa cacggatgtg tttttgatct 361 gcttctctgt cgtaaaccct gcctcttacc acaatgtcca ggaggaatgg gTCCCCGAGC 421 TCAAGGACTG CATGCCTCAC GTGCCTTATG TCCTCATAGG GACCCAGATT GATCTCCGTG 481 ATGACCCAAA AACCTTGGCC CGTTTGCTGT ATATGAAAGA GAAACCTCTC ACTTACGAGC 541 ATGGTGTGAA GCTCGCAAAA GCGATCGGAG CACAGTGCTA CTTGGAATGT TCAGCTCTGA 601 CTCAGAAAGG TCTCAAAGCG GTTTTTGATG AAGCAATCCT CACCATTTTC CACCCCAAGA 661 AAAAGAAGAA ACGCTGTTCT GAGGGTCACA GCTGCTGTTC AATTATCTGC CCAACTTTCT 721 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 781 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 841 GTGGAAAGGA CGACTCTCTT ATCCGTTTTA AAGTGACACG CGTTAAGTCg acaatcaacc 901 tctggattac aaaatttgtg aaagatt