Transcript: Mouse NM_023275.2

Mus musculus ras homolog family member J (Rhoj), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Rhoj (80837)
Length:
2358
CDS:
512..1156

Additional Resources:

NCBI RefSeq record:
NM_023275.2
NBCI Gene record:
Rhoj (80837)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023275.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313430 CAAGCACCTTAACGCTCATTT pLKO_005 1591 3UTR 100% 13.200 18.480 N Rhoj n/a
2 TRCN0000077565 TGTCGTAAACCCAGCCTCTTA pLKO.1 814 CDS 100% 4.950 6.930 N Rhoj n/a
3 TRCN0000312386 TGTCGTAAACCCAGCCTCTTA pLKO_005 814 CDS 100% 4.950 6.930 N Rhoj n/a
4 TRCN0000313500 GTTTGACCACTACGCAGTTAC pLKO_005 673 CDS 100% 10.800 8.640 N Rhoj n/a
5 TRCN0000313499 CAGCACTTGCTTGGACTATAC pLKO_005 713 CDS 100% 10.800 7.560 N Rhoj n/a
6 TRCN0000077567 CATCTGCTTCTCTGTCGTAAA pLKO.1 802 CDS 100% 10.800 7.560 N Rhoj n/a
7 TRCN0000312323 CATCTGCTTCTCTGTCGTAAA pLKO_005 802 CDS 100% 10.800 7.560 N Rhoj n/a
8 TRCN0000047606 GCCCACTGTGTTTGACCACTA pLKO.1 664 CDS 100% 4.050 2.835 N RHOJ n/a
9 TRCN0000077566 GTGTTTGACCACTACGCAGTT pLKO.1 671 CDS 100% 4.050 2.835 N Rhoj n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023275.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03814 pDONR223 100% 87.8% 92.9% None (many diffs) n/a
2 ccsbBroad304_03814 pLX_304 0% 87.8% 92.9% V5 (many diffs) n/a
3 TRCN0000480427 CTCTCTTATCCGTTTTAAAGTGAC pLX_317 46.3% 87.8% 92.9% V5 (many diffs) n/a
Download CSV