Transcript: Human XR_245709.4

PREDICTED: Homo sapiens ras homolog family member J (RHOJ), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RHOJ (57381)
Length:
3418
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_245709.4
NBCI Gene record:
RHOJ (57381)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_245709.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047603 GCCCGTTTGCTGTATATGAAA pLKO.1 891 3UTR 100% 5.625 7.875 N RHOJ n/a
2 TRCN0000047605 CAACACTTGCTCGGACTGTAT pLKO.1 660 3UTR 100% 4.950 6.930 N RHOJ n/a
3 TRCN0000416657 ACTTGGGACTACAATACTAAC pLKO_005 1626 3UTR 100% 10.800 8.640 N RHOJ n/a
4 TRCN0000047606 GCCCACTGTGTTTGACCACTA pLKO.1 611 3UTR 100% 4.050 3.240 N RHOJ n/a
5 TRCN0000432315 CCATGTGTCTCACATTCATTT pLKO_005 1673 3UTR 100% 13.200 9.240 N RHOJ n/a
6 TRCN0000420432 TGACTCAGAAAGGTCTCAAAG pLKO_005 1111 3UTR 100% 10.800 7.560 N RHOJ n/a
7 TRCN0000047604 GATGAAGCAATCCTCACCATT pLKO.1 1140 3UTR 100% 4.950 3.465 N RHOJ n/a
8 TRCN0000047607 TGTCGTAAACCCTGCCTCTTA pLKO.1 761 3UTR 100% 4.950 3.465 N RHOJ n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_245709.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03814 pDONR223 100% 18.7% None 1_458del;957_1076del;1221_3418del n/a
2 ccsbBroad304_03814 pLX_304 0% 18.7% V5 1_458del;957_1076del;1221_3418del n/a
3 TRCN0000480427 CTCTCTTATCCGTTTTAAAGTGAC pLX_317 46.3% 18.7% V5 1_458del;957_1076del;1221_3418del n/a
Download CSV