Construct: ORF TRCN0000480455
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018885.3_s317c1
- Derived from:
- ccsbBroadEn_15229
- DNA Barcode:
- GCCGCCGATATCTCGACAAAGAAG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- IP6K3 (117283)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480455
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 117283 | IP6K3 | inositol hexakisphosphate k... | NM_001142883.1 | 97.4% | 36.9% | (many diffs) |
| 2 | human | 117283 | IP6K3 | inositol hexakisphosphate k... | NM_054111.5 | 97.4% | 36.9% | (many diffs) |
| 3 | human | 117283 | IP6K3 | inositol hexakisphosphate k... | XM_005248842.3 | 97.4% | 36.9% | (many diffs) |
| 4 | human | 117283 | IP6K3 | inositol hexakisphosphate k... | XM_024446323.1 | 97.4% | 36.9% | (many diffs) |
| 5 | human | 117283 | IP6K3 | inositol hexakisphosphate k... | XM_024446324.1 | 97.4% | 36.9% | (many diffs) |
| 6 | human | 117283 | IP6K3 | inositol hexakisphosphate k... | XM_024446325.1 | 97.4% | 36.9% | (many diffs) |
| 7 | human | 117283 | IP6K3 | inositol hexakisphosphate k... | XM_005248843.4 | 66.7% | 4.4% | (many diffs) |
| 8 | human | 117283 | IP6K3 | inositol hexakisphosphate k... | XM_024446326.1 | 66.7% | 4.4% | (many diffs) |
| 9 | human | 117283 | IP6K3 | inositol hexakisphosphate k... | XM_024446327.1 | 66.7% | 4.4% | (many diffs) |
| 10 | human | 117283 | IP6K3 | inositol hexakisphosphate k... | XM_011514295.3 | 61.6% | 56.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 618
- ORF length:
- 549
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggttgtgcaa aacagcgcag acgccgggga catgagggca ggcgtgcagc 121 tggagccctt cctgcaccag gtcggggggc acatgagcgt gatgaagtat gacgagcata 181 cggtgtgcaa gcccctcgtc tcccgggagc agaggttcta tgaatccctg ccgctggcca 241 tgaagcggtt caccccacag tacaaaggta ccgtcacagt gcacctctgg aaagacagca 301 caggccatct cagcttggtt gccaacccag tgaaggagag ccaggagccc ttcaaggtct 361 ccacagagtc ggcggcggtg gccatatggc agacgctcca gcagaccacc ggcagcaatg 421 gcagcgactg cacccttgcc cagtggccgc atgcccagct ggcacgctca cccaaggaga 481 gcccggccaa ggctcttctg aggtccgagc cccacctnan cantcccanc cttntcgntg 541 gtngaaggac accaacggaa accaggttga gaggaagagc ttnaacccgt gggncnnnna 601 atgccaccag ncccacntga ccccgcctgt gctcnnagta cccanagaac aagcgggcat 661 cggttcttgt tgctggaaaa tgtagtgtca cagtacacgc atncctgtgt cctggatctg 721 aagatgggga cccggcagca cggcgatgat gcatcggagg agaagaaggc ccgccacatg 781 aggaagtgtg cgcagagcac ctcagcctgc ctgggtgtgc gcatctgcgg catgcaggtt 841 tatcaaacag ataagnagta ctttctnnnn naagacaagt actatggnag aaaactctca 901 gtggaggggt tcagacaagc cctctatcag ttcctacata atggaagcca ccTCCGGAGG 961 GAGCTCCTGG AGCCCATCCT GCACCAGCTC CGGGCCCTCC TCTCCATCAT TAGGAGCCAG 1021 AGTTCATACC GCTTCTATTC CAGCTCTCTC CTTGTCATCT ATGATGGGCA GGAACCACCA 1081 GAAAGAGCCC CAGGCAGCCC GCATCCTCAC GAGGCTCCCC AGGCAGCCCA CGGTAGCTCT 1141 CCCGGTGGTC TCACCAAGGT TGACATCCGC ATGATTGACT TTGCTCATAC CACATACAAG 1201 GGCTACTGGA ATGAGCACAC CACCTACGAT GGACCAGACC CTGGCTATAT TTTTGGCCTG 1261 GAAAACCTCA TCAGGATCCT GCAGGATATC CAAGAGGGAG AATTGCCAAC TTTCTTGTAC 1321 AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG 1381 TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA 1441 AAGGACGAGC CGCCGATATC TCGACAAAGA AGACGCGTTA AGTCgacaat caacctctgg 1501 attacaaaat ttgtgaaaga tt