Construct: ORF TRCN0000480459
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016628.1_s317c1
- Derived from:
- ccsbBroadEn_11159
- DNA Barcode:
- TGTAATCTGCACTGTAAGTGAATG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ITPRID2 (6744)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480459
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 6744 | ITPRID2 | ITPR interacting domain con... | XM_011511702.3 | 34.7% | 34.7% | 1_1503del |
2 | human | 6744 | ITPRID2 | ITPR interacting domain con... | NM_001287504.2 | 22.1% | 22.1% | 1_2517del;2685_2686ins66 |
3 | human | 6744 | ITPRID2 | ITPR interacting domain con... | NM_001130445.3 | 21.2% | 21.2% | 1_2976del |
4 | human | 6744 | ITPRID2 | ITPR interacting domain con... | XM_005246812.2 | 20.8% | 20.8% | 1_2976del;3198_3199insGTAATGGAACCA |
5 | human | 6744 | ITPRID2 | ITPR interacting domain con... | NM_006751.7 | 19.7% | 18.6% | (many diffs) |
6 | human | 6744 | ITPRID2 | ITPR interacting domain con... | NM_001287503.2 | 19.4% | 19.4% | 1_2976del;3144_3145ins66 |
7 | human | 6744 | ITPRID2 | ITPR interacting domain con... | XM_005246813.2 | 19.4% | 18.3% | (many diffs) |
8 | human | 6744 | ITPRID2 | ITPR interacting domain con... | XM_017004782.2 | 18% | 16.9% | (many diffs) |
9 | human | 6744 | ITPRID2 | ITPR interacting domain con... | XR_002959326.1 | 16.1% | 1_3173del;3975_4958del | |
10 | human | 6744 | ITPRID2 | ITPR interacting domain con... | XR_001738910.2 | 15.2% | 1_3463del;4265_5248del | |
11 | human | 6744 | ITPRID2 | ITPR interacting domain con... | XR_001738905.2 | 15.1% | 1_3496del;4298_5281del | |
12 | human | 6744 | ITPRID2 | ITPR interacting domain con... | XR_001738912.2 | 14.4% | 1_3463del;3685_3686insGTAATGGAACCA;4253_5446del | |
13 | human | 6744 | ITPRID2 | ITPR interacting domain con... | XR_001738911.2 | 14.2% | 1_3611del;4413_5606del | |
14 | human | 6744 | ITPRID2 | ITPR interacting domain con... | XR_001738908.2 | 13.8% | (many diffs) | |
15 | human | 6744 | ITPRID2 | ITPR interacting domain con... | XR_001738906.2 | 13.8% | 1_3701del;3923_3924insGTAATGGAACCA;4491_5684del | |
16 | human | 6744 | ITPRID2 | ITPR interacting domain con... | XR_001738913.2 | 13.7% | (many diffs) | |
17 | human | 6744 | ITPRID2 | ITPR interacting domain con... | NR_109843.2 | 13.6% | 1_3891del;4693_5886del | |
18 | human | 6744 | ITPRID2 | ITPR interacting domain con... | XR_001738907.2 | 12.9% | 1_3701del;3869_3870ins66;4437_5630del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 867
- ORF length:
- 801
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac tgaggaggag aggtttgaag ttgatcagct ccagggtttg agaaattcag 121 tccgaatgga acttcaggac ctggaactgc agctggagga gcgcctgctg ggcctggagg 181 agcagcttcg tgctgtgcgc atgccttcac ccttccgctc ctccgcactc atgggaatgt 241 gtggcagtag aagcgctgat aacttgtcat gcccttctcc attgaatgta atggaaccag 301 tcactgaact gatgcaggag cagtcatacc tgaagtctga attgggcctg ggacttggag 361 aaatgggatt tgaaattcct cctggagaaa gctcagaatc tgttttttcc caagcaacat 421 cagaatcatc ttctgtatgt tctggtccct ctcatgctaa cagaagaact ggagtaCCTT 481 CTACTGCCTC AGTGGGCAAA TCCAAAACCC CATTAGTGGC AAGGAAGAAA GTGTTCCGAG 541 CATCGGTGGC TCTAACGCCA ACAGCTCCTT CTAGAACAGG CTCTGTGCAG ACACCTCCAG 601 ATTTGGAAAG TTCTGAGGAA GTTGATGCAG CTGAAGGAGC CCCAGAAGTT GTAGGACCTA 661 AATCTGAAGT GGAAGAAGGG CATGGAAAAC TCCCATCAAT GCCAGCTGCT GAGGAAATGC 721 ATAAAAATGT GGAGCAAGAT GAGTTGCAGC AAGTCATACG GGAGATTAAA GAGTCTATTG 781 TTGGGGAAAT CAGACGGGAA ATTGTAAGTG GACTTTTGGC AGCAGTATCT TCAAGTAAAG 841 CGTCTAATTC TAAGCAAGAT TATCATTACC CAACTTTCTT GTACAAAGTG GTTGATATCG 901 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 961 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GATGTAATCT 1021 GCACTGTAAG TGAATGACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1081 aagatt