Transcript: Human XM_011511702.3

PREDICTED: Homo sapiens ITPR interacting domain containing 2 (ITPRID2), transcript variant X16, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ITPRID2 (6744)
Length:
4112
CDS:
615..2921

Additional Resources:

NCBI RefSeq record:
XM_011511702.3
NBCI Gene record:
ITPRID2 (6744)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011511702.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140203 GCATTCCGATAGCAGTGGTTT pLKO.1 653 CDS 100% 4.950 6.930 N ITPRID2 n/a
2 TRCN0000144703 GCTTTACCCAAGACAAATGTA pLKO.1 3523 3UTR 100% 5.625 4.500 N ITPRID2 n/a
3 TRCN0000140225 GCACTGGTGGAGGTGTTATTT pLKO.1 2984 3UTR 100% 15.000 10.500 N ITPRID2 n/a
4 TRCN0000121878 GCTGTGTAATACTGGAATTAT pLKO.1 2954 3UTR 100% 15.000 10.500 N ITPRID2 n/a
5 TRCN0000145533 CCATCATCTGTGAAGAAAGAA pLKO.1 1551 CDS 100% 5.625 3.938 N ITPRID2 n/a
6 TRCN0000121696 CTGTGCAATAACTGATTCATT pLKO.1 3308 3UTR 100% 5.625 3.938 N ITPRID2 n/a
7 TRCN0000144343 CTTCCAGACTTATCCAACTTA pLKO.1 3229 3UTR 100% 5.625 3.938 N ITPRID2 n/a
8 TRCN0000121851 GAAATGAATAAGCTGGTGTTT pLKO.1 3721 3UTR 100% 4.950 3.465 N ITPRID2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011511702.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11159 pDONR223 100% 34.7% 34.7% None 1_1503del n/a
2 ccsbBroad304_11159 pLX_304 0% 34.7% 34.7% V5 1_1503del n/a
3 TRCN0000480459 TGTAATCTGCACTGTAAGTGAATG pLX_317 48.8% 34.7% 34.7% V5 1_1503del n/a
Download CSV