Construct: ORF TRCN0000480477
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005557.2_s317c1
- Derived from:
- ccsbBroadEn_00042
- DNA Barcode:
- AGCAATATTAAGGTTTTTTGGCGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- AHCY (191)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480477
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 191 | AHCY | adenosylhomocysteinase | NM_000687.4 | 100% | 100% | |
| 2 | human | 191 | AHCY | adenosylhomocysteinase | NM_001362750.2 | 100% | 100% | |
| 3 | human | 191 | AHCY | adenosylhomocysteinase | XM_017027709.2 | 100% | 100% | |
| 4 | human | 191 | AHCY | adenosylhomocysteinase | NM_001322086.2 | 98.6% | 97.9% | (many diffs) |
| 5 | human | 191 | AHCY | adenosylhomocysteinase | XM_011528656.3 | 98.6% | 97.9% | (many diffs) |
| 6 | human | 191 | AHCY | adenosylhomocysteinase | XM_011528657.2 | 98.6% | 97.9% | (many diffs) |
| 7 | human | 191 | AHCY | adenosylhomocysteinase | XM_011528658.3 | 98.6% | 97.9% | (many diffs) |
| 8 | human | 191 | AHCY | adenosylhomocysteinase | NM_001161766.1 | 93.5% | 93.5% | 0_1ins84 |
| 9 | human | 191 | AHCY | adenosylhomocysteinase | NM_001322084.2 | 93.5% | 93.5% | 0_1ins84 |
| 10 | human | 191 | AHCY | adenosylhomocysteinase | NM_001322085.2 | 93.5% | 93.5% | 0_1ins84 |
| 11 | human | 191 | AHCY | adenosylhomocysteinase | XM_005260317.2 | 93.5% | 93.5% | 0_1ins84 |
| 12 | human | 191 | AHCY | adenosylhomocysteinase | XM_011528659.1 | 93.5% | 93.5% | 0_1ins84 |
| 13 | human | 191 | AHCY | adenosylhomocysteinase | XM_017027710.2 | 70.8% | 70.8% | 0_1ins378 |
| 14 | mouse | 269378 | Ahcy | S-adenosylhomocysteine hydr... | NM_016661.3 | 91% | 96.9% | (many diffs) |
| 15 | mouse | 11615 | Gm4737 | predicted gene 4737 | NM_001304528.1 | 90.6% | 96.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1362
- ORF length:
- 1296
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc tgacaaactg ccctacaaag tcgccgacat cggcctggct gcctggggac 121 gcaaggccct ggacattgct gagaacgaga tgccgggcct gatgcgtatg cgggagcggt 181 actcggcctc caagccactg aagggcgccc gcatcgctgg ctgcctgcac atgaccgtgg 241 agacggccgt cctcattgag accctcgtca ccctgggtgc tgaggtgcag tggtccagct 301 gcaacatctt ctccacccag gaccatgcgg cggctgccat tgccaaggct ggcattccgg 361 tgtatgcctg gaagggcgaa acggacgagg agtacctgtg gtgcattgag cagaccctgt 421 acttcaagga cgggcccctc aacatgattc tggacgacgg gggcgacctc accaacctca 481 tccacaccaa gtacccgcag cttctgccag gcatccgagg catctctgag gagaccacga 541 ctggggtcca caacctctac aagatgatgg ccaatgggat cctcaaggtg cctgccatca 601 atgtcaatga ctccgtcacc aagagcaagt ttgacaacct ctatggctgc cgggagtccc 661 tcatagatgg catcaagcgg gccacagatg tgatgattgc cggcaaggta gcggtggtag 721 caggctatgg tgatgtgggc aagggctgtg cccaggccct gcggggtttc ggagcccgcg 781 tcatcatcac cgagattgac cccatcaacg cactgcaggc tgccatggag ggctatgagg 841 tgaccaccat ggatgaggcc tgtcaggagg gcaacatctt tgtcaccacc acaggctgta 901 ttgacatcat ccttggccgg CACTTTGAGC AGATGAAGGA TGATGCCATT GTGTGTAACA 961 TTGGACACTT TGACGTGGAG ATCGATGTCA AGTGGCTCAA CGAGAACGCC GTGGAGAAGG 1021 TGAACATCAA GCCGCAGGTG GACCGGTATC GGTTGAAGAA TGGGCGCCGC ATCATCCTGC 1081 TGGCCGAGGG TCGGCTGGTC AACCTGGGTT GTGCCATGGG CCACCCCAGC TTCGTGATGA 1141 GTAACTCCTT CACCAACCAG GTGATGGCGC AGATCGAGCT GTGGACCCAT CCAGACAAGT 1201 ACCCCGTTGG GGTTCATTTC CTGCCCAAGA AGCTGGATGA GGCAGTGGCT GAAGCCCACC 1261 TGGGCAAGCT GAATGTGAAG TTGACCAAGC TAACTGAGAA GCAAGCCCAG TACCTGGGCA 1321 TGTCCTGTGA TGGCCCCTTC AAGCCGGATC ACTACCGCTA CTGCCCAACT TTCTTGTACA 1381 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1441 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1501 AGGACGAAGC AATATTAAGG TTTTTTGGCG CACGCGTTAA GTCgacaatc aacctctgga 1561 ttacaaaatt tgtgaaagat t