Construct: ORF TRCN0000480518
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016803.1_s317c1
- Derived from:
- ccsbBroadEn_11649
- DNA Barcode:
- CCTACTCTAAGTAACCGGATATCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RALY (22913)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480518
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 22913 | RALY | RALY heterogeneous nuclear ... | NM_016732.3 | 99.6% | 99.6% | 689_690insCAG |
| 2 | human | 22913 | RALY | RALY heterogeneous nuclear ... | XM_005260334.5 | 99.6% | 99.6% | 689_690insCAG |
| 3 | human | 22913 | RALY | RALY heterogeneous nuclear ... | XM_011528694.3 | 99.6% | 99.6% | 689_690insCAG |
| 4 | human | 22913 | RALY | RALY heterogeneous nuclear ... | XM_011528695.3 | 99.6% | 99.6% | 689_690insCAG |
| 5 | human | 22913 | RALY | RALY heterogeneous nuclear ... | XM_017027731.2 | 99.6% | 99.6% | 689_690insCAG |
| 6 | human | 22913 | RALY | RALY heterogeneous nuclear ... | XM_024451857.1 | 99.6% | 99.6% | 689_690insCAG |
| 7 | human | 22913 | RALY | RALY heterogeneous nuclear ... | XM_024451858.1 | 99.6% | 99.6% | 689_690insCAG |
| 8 | human | 22913 | RALY | RALY heterogeneous nuclear ... | XM_024451859.1 | 99.6% | 99.6% | 689_690insCAG |
| 9 | human | 22913 | RALY | RALY heterogeneous nuclear ... | NM_007367.4 | 94.4% | 94.4% | 325_326ins48;641_642insCAG |
| 10 | human | 22913 | RALY | RALY heterogeneous nuclear ... | XM_005260336.5 | 94.4% | 94.4% | 325_326ins48;641_642insCAG |
| 11 | mouse | 19383 | Raly | hnRNP-associated with letha... | NM_001139513.1 | 84% | 87.1% | (many diffs) |
| 12 | mouse | 19383 | Raly | hnRNP-associated with letha... | XM_006499013.3 | 84% | 87.1% | (many diffs) |
| 13 | mouse | 19383 | Raly | hnRNP-associated with letha... | XM_006499014.3 | 84% | 87.1% | (many diffs) |
| 14 | mouse | 19383 | Raly | hnRNP-associated with letha... | XM_006499015.2 | 84% | 87.1% | (many diffs) |
| 15 | mouse | 19383 | Raly | hnRNP-associated with letha... | NM_001139511.1 | 79.7% | 83.6% | (many diffs) |
| 16 | mouse | 19383 | Raly | hnRNP-associated with letha... | NM_001139512.1 | 79.7% | 83.6% | (many diffs) |
| 17 | mouse | 19383 | Raly | hnRNP-associated with letha... | NM_023130.3 | 79.7% | 83.6% | (many diffs) |
| 18 | mouse | 19383 | Raly | hnRNP-associated with letha... | XM_006499016.2 | 79.7% | 83.6% | (many diffs) |
| 19 | mouse | 19383 | Raly | hnRNP-associated with letha... | XM_017316631.1 | 79.7% | 83.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 990
- ORF length:
- 921
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtccttgaag cttcaggcaa gcaatgtaac caacaagaat gaccccaagt 121 ccatcaactc tcgagtcttc attggaaacc tcaacacagc tctggtgaag aaatcagatg 181 tggagaccat cttctctaag tatggccgtg tggccggctg ttctgtgcac aagggctatg 241 cctttgttca gtactccaat gagcgccatg cccgggcagc tgtgctggga gagaatgggc 301 gggtgctggc cgggcagacc ctggacatca acatggctgg agagcctaag cctgacagac 361 ccaaggggct aaagagagca gcatctgcca tatacagtgg ctacatcttt gactatgatt 421 actaccggga cgacttctac gacaggctct tcgactaccg gggccgtctg tcgcccgtgc 481 cagtgcccag ggcggtccct gtgaagcgac cccgggtcac agtccctttg gtccggcgtg 541 tcaaaactaa cgtacctgtc aagctctttg cccgctccac agctgtcacc accagcTCAG 601 CCAAGATCAA GTTAAAGAGC AGTGAGCTGC AGGCCATCAA GACGGAGCTG ACACAGATCA 661 AGTCCAATAT CGATGCCCTG CTGAGCCGCT TGGAGCAGAT CGCTGCGGAG CAAAAGGCCA 721 ATCCAGATGG CAAGAAGAAG GGTGATGGAG GTGGCGCCAG CGGCGGCGGC GGCGGTGGTG 781 GTGGCAGCGG TGGCGGTGGC AGTGGTGGTG GCGGTGGCGG TGGCAGCAGC CGGCCACCAG 841 CCCCCCAAGA GAACACAACT TCTGAGGCAG GCCTGCCCCA GGGGGAAGCA CGGACCCGAG 901 ACGACGGCGA TGAGGAAGGG CTCCTGACAC ACAGCGAGGA AGAGCTGGAA CACAGCCAGG 961 ACACAGACGC GGATGATGGG GCCTTGCAGT TGCCAACTTT CTTGTACAAA GTGGTTGATA 1021 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1081 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGACCTAC 1141 TCTAAGTAAC CGGATATCAA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1201 tgaaagatt