Transcript: Mouse NM_001139511.1

Mus musculus hnRNP-associated with lethal yellow (Raly), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Raly (19383)
Length:
1711
CDS:
449..1339

Additional Resources:

NCBI RefSeq record:
NM_001139511.1
NBCI Gene record:
Raly (19383)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001139511.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313318 TGGAGAGCCCAAGCCTAATAG pLKO_005 718 CDS 100% 13.200 18.480 N Raly n/a
2 TRCN0000349952 CGATACCTGTCAAGCTCTTTG pLKO_005 882 CDS 100% 10.800 15.120 N Raly n/a
3 TRCN0000112062 CGTGTTACAGTCCCTTTGGTT pLKO.1 845 CDS 100% 3.000 2.400 N Raly n/a
4 TRCN0000312298 CGTGTTACAGTCCCTTTGGTT pLKO_005 845 CDS 100% 3.000 2.400 N Raly n/a
5 TRCN0000374794 CCTTGCAGTAAGCAGCTTAAC pLKO_005 1329 CDS 100% 10.800 7.560 N Raly n/a
6 TRCN0000112064 CGGGTCTTCATCGGAAATCTA pLKO.1 512 CDS 100% 5.625 3.938 N Raly n/a
7 TRCN0000112061 GCCATCTACAGGCTGTTTGAT pLKO.1 767 CDS 100% 5.625 3.938 N Raly n/a
8 TRCN0000112060 CATCTCTGGATGCCAGTCTAT pLKO.1 1407 3UTR 100% 4.950 3.465 N Raly n/a
9 TRCN0000312299 CATCTCTGGATGCCAGTCTAT pLKO_005 1407 3UTR 100% 4.950 3.465 N Raly n/a
10 TRCN0000433520 TGACACAGATCAAGTCCAATA pLKO_005 981 CDS 100% 10.800 7.560 N RALY n/a
11 TRCN0000001272 GATGGCAAGAAGAAGGGTGAT pLKO.1 1058 CDS 100% 4.050 2.835 N RALY n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001139511.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11649 pDONR223 100% 79.7% 83.6% None (many diffs) n/a
2 ccsbBroad304_11649 pLX_304 0% 79.7% 83.6% V5 (many diffs) n/a
3 TRCN0000480518 CCTACTCTAAGTAACCGGATATCA pLX_317 42.7% 79.7% 83.6% V5 (many diffs) n/a
Download CSV