Transcript: Human XM_011528695.3

PREDICTED: Homo sapiens RALY heterogeneous nuclear ribonucleoprotein (RALY), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RALY (22913)
Length:
1761
CDS:
485..1405

Additional Resources:

NCBI RefSeq record:
XM_011528695.3
NBCI Gene record:
RALY (22913)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528695.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001274 CGACTTCTACGACAGGCTCTT pLKO.1 847 CDS 100% 4.050 5.670 N RALY n/a
2 TRCN0000001275 CAGGACACAGACGCGGATGAT pLKO.1 1370 CDS 100% 1.650 2.310 N RALY n/a
3 TRCN0000001273 CATATACAGTGGCTACATCTT pLKO.1 805 CDS 100% 4.950 3.960 N RALY n/a
4 TRCN0000412277 ACGTACCTGTCAAGCTCTTTG pLKO_005 966 CDS 100% 10.800 7.560 N RALY n/a
5 TRCN0000436060 AGACCATCTTCTCTAAGTATG pLKO_005 600 CDS 100% 10.800 7.560 N RALY n/a
6 TRCN0000433520 TGACACAGATCAAGTCCAATA pLKO_005 1065 CDS 100% 10.800 7.560 N RALY n/a
7 TRCN0000428900 ACCAGCTCAGCCAAGATCAAG pLKO_005 1007 CDS 100% 4.950 3.465 N RALY n/a
8 TRCN0000412282 CAACACAGCTCTGGTGAAGAA pLKO_005 568 CDS 100% 4.950 3.465 N RALY n/a
9 TRCN0000425957 GCCTTTGTTCAGTACTCCAAT pLKO_005 656 CDS 100% 4.950 3.465 N RALY n/a
10 TRCN0000422999 CAAGAGAACACAACTTCTGAG pLKO_005 1259 CDS 100% 4.050 2.835 N RALY n/a
11 TRCN0000427633 GAGTTACTGGCCTACTCCTTC pLKO_005 1576 3UTR 100% 4.050 2.835 N RALY n/a
12 TRCN0000001272 GATGGCAAGAAGAAGGGTGAT pLKO.1 1142 CDS 100% 4.050 2.835 N RALY n/a
13 TRCN0000432707 TTGCAGTAAGCAGCCTGACAG pLKO_005 1397 CDS 100% 4.050 2.835 N RALY n/a
14 TRCN0000001276 CTATGATTACTACCGGGACGA pLKO.1 829 CDS 100% 2.160 1.512 N RALY n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528695.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11649 pDONR223 100% 99.6% 99.6% None 689_690insCAG n/a
2 ccsbBroad304_11649 pLX_304 0% 99.6% 99.6% V5 689_690insCAG n/a
3 TRCN0000480518 CCTACTCTAAGTAACCGGATATCA pLX_317 42.7% 99.6% 99.6% V5 689_690insCAG n/a
Download CSV