Transcript: Human NM_007367.4

Homo sapiens RALY heterogeneous nuclear ribonucleoprotein (RALY), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
RALY (22913)
Length:
6165
CDS:
314..1186

Additional Resources:

NCBI RefSeq record:
NM_007367.4
NBCI Gene record:
RALY (22913)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007367.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001275 CAGGACACAGACGCGGATGAT pLKO.1 1151 CDS 100% 1.650 2.310 N RALY n/a
2 TRCN0000412277 ACGTACCTGTCAAGCTCTTTG pLKO_005 747 CDS 100% 10.800 7.560 N RALY n/a
3 TRCN0000436060 AGACCATCTTCTCTAAGTATG pLKO_005 429 CDS 100% 10.800 7.560 N RALY n/a
4 TRCN0000433520 TGACACAGATCAAGTCCAATA pLKO_005 846 CDS 100% 10.800 7.560 N RALY n/a
5 TRCN0000428900 ACCAGCTCAGCCAAGATCAAG pLKO_005 788 CDS 100% 4.950 3.465 N RALY n/a
6 TRCN0000412282 CAACACAGCTCTGGTGAAGAA pLKO_005 397 CDS 100% 4.950 3.465 N RALY n/a
7 TRCN0000425957 GCCTTTGTTCAGTACTCCAAT pLKO_005 485 CDS 100% 4.950 3.465 N RALY n/a
8 TRCN0000422999 CAAGAGAACACAACTTCTGAG pLKO_005 1040 CDS 100% 4.050 2.835 N RALY n/a
9 TRCN0000427633 GAGTTACTGGCCTACTCCTTC pLKO_005 1357 3UTR 100% 4.050 2.835 N RALY n/a
10 TRCN0000001272 GATGGCAAGAAGAAGGGTGAT pLKO.1 923 CDS 100% 4.050 2.835 N RALY n/a
11 TRCN0000432707 TTGCAGTAAGCAGCCTGACAG pLKO_005 1178 CDS 100% 4.050 2.835 N RALY n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007367.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11649 pDONR223 100% 94.4% 94.4% None 325_326ins48;641_642insCAG n/a
2 ccsbBroad304_11649 pLX_304 0% 94.4% 94.4% V5 325_326ins48;641_642insCAG n/a
3 TRCN0000480518 CCTACTCTAAGTAACCGGATATCA pLX_317 42.7% 94.4% 94.4% V5 325_326ins48;641_642insCAG n/a
Download CSV