Construct: ORF TRCN0000480602
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007576.1_s317c1
- Derived from:
- ccsbBroadEn_11789
- DNA Barcode:
- CTCGCGGCTGGCTCAATGGGTCCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NECTIN3 (25945)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480602
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 25945 | NECTIN3 | nectin cell adhesion molecu... | NM_001243286.2 | 99.9% | 99.7% | 752C>A |
| 2 | human | 25945 | NECTIN3 | nectin cell adhesion molecu... | XM_017006126.1 | 70.7% | 69.8% | (many diffs) |
| 3 | human | 25945 | NECTIN3 | nectin cell adhesion molecu... | XM_017006123.1 | 66.7% | 65.6% | (many diffs) |
| 4 | human | 25945 | NECTIN3 | nectin cell adhesion molecu... | NM_015480.3 | 66.6% | 64.8% | 752C>A;1065_1090del;1125_1647del |
| 5 | human | 25945 | NECTIN3 | nectin cell adhesion molecu... | NM_001243288.2 | 64% | 60.2% | (many diffs) |
| 6 | human | 25945 | NECTIN3 | nectin cell adhesion molecu... | XM_011512663.1 | 63% | 61.2% | (many diffs) |
| 7 | human | 25945 | NECTIN3 | nectin cell adhesion molecu... | XM_017006125.1 | 60.3% | 56% | (many diffs) |
| 8 | human | 25945 | NECTIN3 | nectin cell adhesion molecu... | XM_017006124.1 | 59.1% | 56.1% | (many diffs) |
| 9 | human | 25945 | NECTIN3 | nectin cell adhesion molecu... | XR_924122.2 | 46.3% | (many diffs) | |
| 10 | human | 25945 | NECTIN3 | nectin cell adhesion molecu... | XR_002959508.1 | 36.6% | (many diffs) | |
| 11 | human | 25945 | NECTIN3 | nectin cell adhesion molecu... | XM_017006127.2 | 27.9% | 26.2% | (many diffs) |
| 12 | mouse | 58998 | Nectin3 | nectin cell adhesion molecu... | XM_006522434.3 | 80.2% | 82.1% | (many diffs) |
| 13 | mouse | 58998 | Nectin3 | nectin cell adhesion molecu... | NM_021497.2 | 74.9% | 76.7% | (many diffs) |
| 14 | mouse | 58998 | Nectin3 | nectin cell adhesion molecu... | NM_021496.3 | 64.4% | 65.8% | (many diffs) |
| 15 | mouse | 58998 | Nectin3 | nectin cell adhesion molecu... | NM_021495.4 | 60.8% | 61% | (many diffs) |
| 16 | mouse | 58998 | Nectin3 | nectin cell adhesion molecu... | XR_384583.3 | 29.1% | (many diffs) | |
| 17 | mouse | 58998 | Nectin3 | nectin cell adhesion molecu... | XR_001781846.1 | 9.8% | (many diffs) | |
| 18 | mouse | 58998 | Nectin3 | nectin cell adhesion molecu... | XR_001781848.1 | 9.7% | (many diffs) | |
| 19 | mouse | 58998 | Nectin3 | nectin cell adhesion molecu... | XR_001781847.1 | 9.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1164
- ORF length:
- 1098
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gcggaccctg cggccgtccc cgctgtgtcc tggaggcggc aaagcacaac 121 tttcctccgc ttctctcctc ggagccgggc tcctgctgca gcccccgacg ccacctccgc 181 tgctgctgct gctcttcccg ctgctgctct tctccaggct ctgtggtgcc ttagctggac 241 caattattgt ggagccacat gtcacagcag tatggggaaa gaatgtttca ttaaagtgtt 301 taattgaagt aaatgaaacc ataacacaga tttcatggga gaagatacat ggcaaaagtt 361 cacagactgt tgcagttcac catccccaat atggattctc tgttcaagga gaatatcagg 421 gaagagtctt gtttaaaaat tactcactta atgatgcaac aattactctg cataacatag 481 gattctctga ttctggaaaa tacatctgca aagctgttac attcccgctt ggaaatgccc 541 agtcctctac aactgtaact gtgttagttg aacccactgt gagcctgata aaagggccag 601 attctttaat tgatggagga aatgaaacag tagcagccat ttgcatcgca gccactggaa 661 aacccgttgc acatattgac tgggaaggtg atcttggtga aatggaatcc actacaactt 721 cttttccaaa tgaaacggca acgattatca gccagtacaa gctatttcca aCCAGATTTG 781 CTAGAGGAAG GCGAATTACT TGTGTTGTAA AACATCAAGC CTTGGAAAAG GACATCCGAT 841 ACTCTTTCAT ATTAGACATA CAGTATGCTC CTGAAGTTTC GGTAACAGGA TATGATGGAA 901 ATTGGTTTGT AGGAAGAAAA GGTGTTAATC TCAAATGTAA TGCTGATGCA AATCCACCAC 961 CCTTCAAATC TGTGTGGAGC AGGTTGGATG GACAATGGCC TGATGGTTTA TTGGCTTCAG 1021 ACAATACTCT TCATTTTGTC CATCCATTGA CTTTCAATTA TTCTGGTGTT TATATCTGTA 1081 AAGTGACCAA TTCCCTTGGT CAAAGAAGTG ACCAAAAAGT CATCTACATT TCAGCCTACA 1141 ATTCAGTGGC ATCCCTCAAC TGCTGCTCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1201 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1261 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAC TCGCGGCTGG 1321 CTCAATGGGT CCTACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1381 att