Transcript: Human XM_017006123.1

PREDICTED: Homo sapiens nectin cell adhesion molecule 3 (NECTIN3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NECTIN3 (25945)
Length:
9921
CDS:
231..1856

Additional Resources:

NCBI RefSeq record:
XM_017006123.1
NBCI Gene record:
NECTIN3 (25945)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006123.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063347 GTGCCTTAGCTGGACCAATTA pLKO.1 484 CDS 100% 13.200 18.480 N NECTIN3 n/a
2 TRCN0000431295 ATCCGATACTCTTTCATATTA pLKO_005 1092 CDS 100% 15.000 10.500 N NECTIN3 n/a
3 TRCN0000431857 ATCAGCCAGTACAAGCTATTT pLKO_005 1005 CDS 100% 13.200 9.240 N NECTIN3 n/a
4 TRCN0000063343 GCGAATTACTTGTGTTGTAAA pLKO.1 1049 CDS 100% 13.200 9.240 N NECTIN3 n/a
5 TRCN0000063346 CCATCCATTGACTTTCAATTA pLKO.1 1298 CDS 100% 13.200 7.920 N NECTIN3 n/a
6 TRCN0000341001 TCACTTAATGATGCAACAATT pLKO_005 702 CDS 100% 13.200 7.920 N Nectin3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006123.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11789 pDONR223 100% 66.7% 65.6% None (many diffs) n/a
2 ccsbBroad304_11789 pLX_304 0% 66.7% 65.6% V5 (many diffs) n/a
3 TRCN0000480602 CTCGCGGCTGGCTCAATGGGTCCT pLX_317 36% 66.7% 65.6% V5 (many diffs) n/a
Download CSV